Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (185)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Anderson, S.
Right arrow Articles by Rubenstein, J. L.R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anderson, S.
Right arrow Articles by Rubenstein, J. L.R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Cerebral Cortex, Vol. 9, No. 6, 646-654, September 1999
© 1999 Oxford University Press

Differential Origins of Neocortical Projection and Local Circuit Neurons: Role of Dlx Genes in Neocortical Interneuronogenesis

Stewart Anderson, Marina Mione, Kyuson Yun and John L.R. Rubenstein

Nina Ireland Laboratory of Developmental Neurobiology, Center for Neurobiology and Psychiatry, Department of Psychiatry and Programs in Neuroscience, Developmental Biology and Biomedical Sciences, 401 Parnassus Avenue, University of California at San Francisco, CA, 94143-0984, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Herein we review the evidence that neocortical projection neurons and interneurons are derived from distinct regions within the telencephalon. While neocortical projection neurons are derived from the ventricular zone of the neocortex, neocortical interneurons appear to be derived from the germinal zone of the basal ganglia. These interneurons follow a tangential migratory pathway from the ganglionic eminences to the cortex. Interneurons of the olfactory bulb follow a distinct tangential migration from the basal ganglia. The Dlx homeobox genes, which are essential for basal ganglia differentiation, are also required for the development of neocortical and olfactory bulb interneurons. Furthermore, evidence is presented that retroviral-mediated expression of DLX2 in neocortical cells can induce GABAergic interneuron differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
There are two general classes of neocortical neurons, the excitatory pyramidal neurons, which typically send their axons to distant targets, and the inhibitory (GABAergic) interneurons, which form only local synaptic connections. The inhibitory neurons comprise 15–30% of all neocortical neurons (Parnavelas et al., 1977Go; Hendry et al., 1987Go; Meinecke and Peters, 1987Go). Despite their smaller number, the inhibitory neurons play a vital role in modulating neocortical functions. Recent evidence suggests that cortical projection neurons and interneurons are derived from distinct proliferative zones. Most differentiating neocortical neurons migrate from the ventricular zone (VZ) towards the pial surface along the processes of radial glia (Rakic, 1972Go; Misson et al., 1991Go, O'Rourke et al., 1992Go; Tan and Breen, 1993Go; Tan et al., 1998Go). However, as described below, there is a substantial amount of tangential migration within the nascent neocortex (Walsh and Cepko, 1988Go; O'Rourke et al., 1992Go; Mione et al., 1997Go), much of it originating from the subcortical telencephalon (De Carlos et al., 1996Go; Anderson et al., 1997bGo; Tamamaki et al., 1997Go). This paper will review the emerging evidence that cortical projection neurons originate from the cortical VZ, whereas the majority of cortical interneurons are born in the basal ganglia anlage (Anderson et al., 1997bGo). In addition, evidence will be presented that suggests that the Dlx-2 gene can support the expression of a GABA-ergic phenotype in neocortical cells.

Cortical and Subcortical Origins of Cortical Neurons: Radial Migration of Projection Neurons and Tangential Migration of Interneurons

Until the late 1980s, experimental evidence supported a model in which most newborn cortical neurons migrate radially from the VZ to the overlying mantle zone (MZ) (Rakic, 1988Go), although the potential for tangential migrations was recognized (for example see Karten, 1969Go; Fig. 1Go of Boulder Committee, 1970Go). This radial relationship between progenitor cells and mature neurons formed the foundation for the Protomap model of neocortical regionalization (Rakic, 1988Go). Subsequently, experiments using lineage analysis with retroviral vectors (Price and Thurlow, 1988Go; Walsh and Cepko, 1988Go; Austin and Cepko, 1990Go) and vital dyes (O'Rourke et al., 1992Go; Fishell et al., 1993Go) demonstrated substantial tangential migrations within the neocortex. While most lineage analyses supported the predominance of radial migration (Luskin et al., 1988Go; Tan and Breen, 1993Go; Kornack and Rakic, 1995Go; Tan et al., 1998Go), the dispersion of many clonally related cells with respect to their site of origin called into question whether neocortical regional specification could indeed be regulated by positional information within its VZ.



View larger version (106K):
[in this window]
[in a new window]
 
Figure 1.  The lateral (A) and medial (B and C) routes of subcortical to neocortical migration. A shows a nissl stain of a coronal E12.5 section on the right, with radial glial fibers shown in yellow. The pattern of radial glial processes extending from the striatopallial angle and the ‘pallial’ portion of the LGE was derived from observations of DiI labeling in slices, and from other studies (Misson et al., 1991Go; De Carlos et al., 1996Go). The left side of A shows Dlx5 expression in a serial section to that on the right. Note that the expression domain of Dlx5 in the LGE demarcates the boundary, within the SVZ and mantle, between the striatal (basal) LGE and the neocortical (pallial) portion of the LGE. Abbreviations: Ncx, neocortex; Pcx, paleocortex; Hp, hippocampus. B and C show DLX-1 immunoreactivity in a sagittal section from E16.5 mouse embryos. The red lines in B indicate the hypothetical migration path of cells from the LGE, septal, and retrobulbar region into the rostral neocortex. Later in gestation and postnatally, cells migrate along this pathway into the olfactory bulb (the rostral migatory stream). The arrow in C shows the DLX-1 positive cells that may be moving dorsally from the retrobulbar region into the neocortex. GABA immunoreactivity labels a similar distribution of cells (Meyer et al., 1998Go). Abbreviations: AOB, accessory olfactory bulb; DTh, dorsal thalamus; OB, olfactory bulb; Sep, septal area; RMS, rostral migratory stream; VTh, ventral thalamus.

 
Beyond describing migration patterns of clonally related cells, lineage studies have also explored the relationship between migration patterns and cell phenotype. Clones of glia tend to be more dispersed than neuronal clones (Luskin et al., 1988Go). More recently, experiments using retroviral labelling or chimeric embryos provided evidence that radially migrating cells give rise primarily to projection neurons and tangentially migrating cells give rise to interneurons (Mione et al., 1997Go; Tan et al., 1998Go). However, these studies did not address the origin of the tangentially migrating cells.

Tangentially Migrating Interneuron Precursors in the Neocortex may Originate in the Basal Telencephalon

Recent investigations of neuronal migration suggested that cells migrate from the lateral ganglionic eminence (LGE), the primordium of the striatum (Deacon et al., 1994Go; Olsson et al., 1995Go), into the neocortex via the SVZ and/or mantle zone. Focal tracer injections have been made into the LGE of rat embryos (De Carlos et al., 1996Go). Although most of the cell migration from the LGE appeared to be radially directed towards the striatal mantle and the primary olfactory cortex, a few cells migrated tangentially into the neocortex. We found a robust cell migration from the mouse basal telencephalon to the cortex using slice cultures; this migration is eliminated when basal ganglia differentiation is blocked in mice lacking the Dlx1 and Dlx2 homeobox genes (Anderson et al., 1997bGo). Likewise, it has been demonstrated (Tamamaki et al., 1997Go) that migration from the LGE into the cortex using both cultures of rostral telencephalon and in-utero injections into E16 rat embryos. Neurotrophin-4 has been applied to E16 forebrain slice cultures (Brunstrom et al., 1997Go) and heterotopias have been found to develop in the neocortical marginal zone; these authors provided evidence for an LGE origin of the cells in the ectopia (Brunstrum et al., 1998).

What types of cells migrate from the basal telencephalon to the cerebral cortex? Several lines of evidence suggest that one or more type of GABAergic interneuron contribute to this tangential migration. First, GABA immunoreactive cells can be found in the lateral striatal mantle and the intermediate zone of the neocortex at early stages of telencephalic development (mouse E12.5). Many of these cells have a morphology and orientation that suggests they may be migrating from the LGE into the neocortex (Van Eden et al., 1989Go; Del Rio et al., 1992Go; DeDiego et al., 1994Go). Second, as described above lineage analyses support the concept that radially oriented neocortical clones tend to contain projection neurons and are clonally distinct from tangentially dispersed clones which tend to contain interneurons (Mione et al., 1997Go; Tan et al., 1998Go). Third, Brunstrom et al. observed that many cells in the NT4-induced marginal zone ectopia were GABAergic (Brunstrom et al., 1998Go). Finally, we provided three lines of evidence that some cells migrating from the basal telencephalon into the neocortex were GABAergic (Anderson et al., 1997bGo). We found that many tangentially migrating cells from the basal telencephalon express GABA and/or calbindin. Surgically separating the basal ganglia from the cortex greatly decreased the number of cortical GABA-ergic, Dlx1-positive and calbindin-positive cells; Dlx1/ Dlx2 mutant mice, which lack this tangential migration, have a four-fold reduction in neocortical GABAergic and calbindinpositive cells on the day of birth (when these animals die) (Anderson et al., 1997bGo).

The MGE is a Major Source of Tangentially Migrating GABAergic and Calbindin-positive Cells that Migrate from the Basal Telencephalon into the Cortex

Although evidence suggests that many interneurons in the maturing neocortex are derived from the basal telencephalon, their precise origin has not been demonstrated. There are several histologically and morphologically distinct primordia within the basal telencephalon, including the lateral ganglionic eminence (LGE), medial ganglionic eminence (MGE), septum (SE) and caudal ganglionic eminence (CGE). These are believed to give rise to the striatum, pallidum, septum and amygdala, respectively (Deacon et al., 1994Go; Olsson et al., 1995Go). There is now evidence for the genetic basis underlying the regional differences in these primordia. For instance, while normal cell migration out of the LGE and MGE requires Dlx1 and Dlx2 (Anderson et al., 1997b and unpublished data), only the MGE requires the Nkx2.1 homeobox gene (Sussel et al., unpublished data).

Based in part upon the analysis of the Nkx2.1 and Dlx1/Dlx2 mutant mice, different subcortical primordia appear to produce interneurons which migrate tangentially along distinct pathways. Mice that have a mutation of the Nkx2.1 homeobox gene lack MGE specification, whereas the LGE specification and differentiation appears to be normal (Sussel et al., unpublished data). At E18.5 these mutants lack most calbindin-expressing cells in the cortex, and have about a two-fold reduction in cortical GABAergic interneurons. These results suggest that the MGE is an important source of subcortical cells that migrate into the neocortex. This hypothesis is substantiated using DiI labelling of the MGE in slice cultures, which reveals migrations from the MGE through the LGE and then into the cortex (Lavdas et al., 1999Go) (S. Anderson et al., unpublished data; Sussel et al., unpublished data).

By comparing the neocortical phenotypes of the Nkx2.1 mutants (which lack migration from the MGE) and the Dlx1/ Dlx2 mutants (which lack migration from both MGE and LGE), the subcortical origins of neocortical cells can be examined. Whereas Dlx1/Dlx2 and Nkx2.1 mutants have a similar reduction in neocortical calbindin-positive cells, fewer GABAergic neurons are detectable in the Dlx1 /Dlx2 (~75% of wild type) than the Nkx2.1 mutants (~50% of wild type) (Anderson et al., 1997bGo) (Sussel et al., unpublished data). Additionally, in the Nkx2.1 mutants DLX2 immunoreactivity is greatly reduced in the superficial portion of the neocortex, but is only reduced ~50% in the intermediate zone and deeper layers of the cortical plate. We are currently investigating whether the residual GABAergic and DLX-positive cortical neurons in the Nkx2.1 mutants migrate from the LGE. If so, it implies that cortical cells migrating from the MGE and LGE may follow distinct pathways, with the marginal zone being primarily utilized by the MGE derived cells.

There is additional evidence for distinct origins and intratelencephalic migration pathways of subcortical cells. There is a well-described tangential migration of precursors of GABAergic interneurons from the basal telencephalon into the olfactory bulb, known as the rostral migratory stream (Hinds, 1968Go; Luskin, 1993Go; Lois and Alvarez-Buylla, 1994Go). Interneurons derived from this pathway do not differentiate in the Dlx1/Dlx2 mutants, e.g. there is no detectable GABA in the olfactory bulb (Anderson et al., 1997aGo; Bulfone et al., 1998Go), whereas their differentiation appears to be normal in the Nkx2.1 mutants (Sussel et al., unpublished data). Thus, the LGE and perhaps septum are required for this rostral interneuron migration, whereas the MGE may have a primary role in the dorsal tangential migration.

Potential Guidance Mechanisms for Tangential Migration into the Neocortex

Essentially nothing is known about the mechanisms that guide the tangentially migrating cells from the MGE and LGE into the cerebral cortex and then into their final positions within the cerebral cortex. On the other hand, some mechanisms have been elucidated for the rostral migratory stream. These cells appear to crawl over each other in long chains within the SVZ (Lois et al., 1996). At postnatal ages, this ‘chain migration’ takes place in channels created by specialized cells (Lois et al., 1996Go). Sialylated NCAM is required to support the migration (Tomasiewicz et al., 1993Go; Hu et al., 1996Go). There is no evidence that these cells are migrating along the fibres of axon tracts or of radial glial cells. Chemotrophic factors may play a role in guiding this migration, as the septum appears to produce a chemorepellent factor for these migrating cells (Hu and Rutishauser, 1996Go), although no chemoattractant has been identified.

Aside from its dependence on the Dlx1/2 genes, it is unknown whether the basal ganglia-neocortex migration has any of the characteristics of the rostral migratory stream. Our preliminary results using explants of wild-type neocortex, LGE, MGE or lamina terminalis, grown in collagen gels, have failed to demonstrate any chemorepulsive or attractive activity for migrating cells. We observe robust cell migration into the collagen from MGE or LGE explants whether or not explants from the neocortex, MGE, or lamina terminalis were placed nearby (Anderson and Rubenstein, unpublished data). It should be noted that a negative result from such experiments by no means rules out the possibility that some chemotrophic activity for these regions exists in vivo. We have also examined whether cortical interneuronogenesis is affected in mice that have greatly reduced expression of netrin. Netrin is an extracellular protein expressed at high levels in the prenatal basal ganglia (Metin et al., 1997) that has chemoattractant and chemorepellent properties for axon growth and cell migrations (Kennedy et al., 1994Go; Serafini et al., 1996Go). In newborn netrin –/– mice we did not detect a reduction in cortical interneurons, suggesting that the basal ganglia to neocortex migration was not affected (data not shown). We made the same observations in mice lacking one of the netrin receptors (DCC) (data not shown).

Axons could also provide a mechanism for the guidance of tangentially migrating neurons (Rakic, 1985Go). Evidence for tangential migration along axons has been reported in the chick forebrain (Gray et al., 1990Go; Golden et al., 1997Go), as well as by LHRH containing cells in the basal telencephalon (Yoshida et al., 1995Go). Within the intermediate zone of the dorsal neocortex, only a few tangentially migrating cells have been shown to make specialized contacts with axons (O'Rourke et al., 1995Go). However, it is unclear whether tangentially migrating cells from the basal telencephalon interact with cortical axons as they first encounter them in the developing internal capsule. In the mouse, corticofugal axons appear in the SVZ and the mantle zone of the LGE at approximately embryonic day 12.5 (E12.5) (Sheth et al., 1998Go); the same age at which we first detect subcortical cells entering the neocortex near the striatopallial angle. E12.5 is also the age at which GABA, calbindin and DLX1 or DLX2 immunoreactive cells first appear in the intermediate zone of the lateral neocortex (Del Rio et al., 1992Go; Anderson et al., 1997bGo) (S. Anderson and J.L.R. Rubenstein, unpublished data). At E13.5, calbindin expressing, tangentially oriented cells in the neocortical intermediate zone appear to be in close apposition with corticofugal fibers at the striatopallial angle (Metin and Godement, 1996Go). In light of other evidence that these calbindin immunoreactive cells migrate from the basal forebrain (Anderson et al., 1997bGo), these findings are suggestive of an interaction between corticofugal axons and the tangentially migrating cells (Metin, 1998Go). The semaphorin family of secreted guidance molecules (Kolodkin et al., 1993Go; Puschel et al., 1995Go), which can mediate both attractive and repulsive cortical axon growth responses (Bagnard et al., 1998Go), could be a reasonable candidate for mediating tangential neuronal migration along corticofugal axons. It should also be noted that in the region of the lateral neocortex some radial glial fibers follow a course that is roughly parallel to the pial surface (Misson et al., 1991Go) (see Fig. 1Go), and thus could potentially support the initial guidance of tangential migration into the neocortex.

Dlx Genes may be Required for Specification of GABAergic Cells in the Neocortex

At the earliest stages of differentiation within the telencephalon there is a remarkable segregation of GABAergic and non-GABAergic cells. GABAergic cells are found in the basal telencephalon, the same region where the Dlx genes are expressed. In the Dlx1/2 mutants, GABA expression in the basal telencephalon is not blocked. Thus, many of the cells that accumulate within the Dlx1/2 mutant striatal SVZ express GABA and its synthesizing enzyme GAD67 despite their failure to migrate into the mantle zone, i.e. the striatum, olfactory bulb, and neocortex (S. Anderson and J.L.R. Rubenstein, unpublished data). This shows that Dlx1 and Dlx2 are not required to express glutamic acid decarboxylase (GAD) in the LGE and MGE. We consider it likely that there are genes which share some functions with the Dlx1 and Dlx2, which can take the place of Dlx1 and Dlx2 in controlling the GABAergic specification in the basal ganglia.

On the other hand, several lines of evidence suggest that Dlx1 and Dlx2 are required for the development of many neocortical GABAergic neurons. Around E12.5, DLX1, DLX2 and GABA immunoreactive cells appear to spread from the LGE into the adjacent cortex coincidently. GABA and GAD67 immunoreactivity is greatly reduced in the neocortex of Dlx1/2 mutants (Anderson et al., 1997bGo). This is particularly striking when comparing GAD67 expression in the marginal zones of the neocortex and the paleocortex [Fig. 4 in (Anderson et al., 1997bGo)]. DLX1 and DLX2 expression, which is present in many marginal zone cells of the wild-type neocortex, also has an abrupt boundary in layer 1 at this same position (Fig. 2Go). Furthermore, we have observed expression of DLX1 in a subset cortical GABAergic cells at E13.5 (Anderson et al., 1997bGo), and at P0 (Fig. 2Go), and have evidence that DLX1 and DLX2 are expressed in the cells that are tangentially migrating from the basal telencephalon to the neocortex.



View larger version (120K):
[in this window]
[in a new window]
 
Figure 2.  DLX1 (blue–black) and GABA (brown) immunoreactivity at P0. A shows a low power view of an 8 µm coronal section; the box indicates the region shown in B, and the black arrows in A and B show the region of transition from neocortex to paleocortex. Note the presence of many DLX1 immunoreactive cells in layer I of the neocortex (Ncx), whereas far fewer cells are detected in the paleocortex (Pcx). In the Dlx1/2 mutants GAD67 and GABA immunoreactivity is dramatically reduced in layer I of the neocortex, but are normal in layer 1 of the paleocortex (Anderson et al., 1997bGo). C shows cells in a deep region of the cortical plate in lateral neocortex (white arrow in B). Note the co-labeling for GABA and DLX1 in a cell (black arrow), and two cells that reacted for either GABA (black arrowhead) or DLX1 (white arrow). Less than 10% of GABA immunoreactive cells also express detectable levels of DLX1 in this preparation. It is possible that Dlx1 (and Dlx2) expression is down-regulated as differentiation proceeds. Abbreviations: GP, globus pallidus; Hp, hippocampus; Ncx, neocortex; Pcx, paleocortex; St, striatum; Thal, thalamus.

Figure 3.  A–F Immunohistochemical analysis of cortical cultures from wild type (wt) (A, D) and Dlx1/2 –/– (B, C, E, F) mouse forebrain, infected with a control virus (A, B, D, E) or with a LZRSpBMN–Dlx2 virus (C, F). AC Dlx2 immunoreactivity; DF GABA immunoreactivity. A Approximately 30% of the cortical cells grown in the presence of bFGF for 5 days show Dlx2 immunoreactive nuclei. B No Dlx2 immunoreactivity could be detected in cultures derived from Dlx1/2 –/– mice. C Upon infection with LZRSpBMN–Dlx2 virus, Dlx2 is expressed in infected cells. D Over 20% of the cells in the cultures derived from wild type cortices are GABA immunoreactive. E Very few GABA+ cells are found in cultures derived from Dlx1/2 –/– mice. F Infection of Dlx1/2 –/– cells with a recombinant retrovirus encoding for Dlx2 induces an increase in the number of GABA+ cells. Calibration bar: 20 µm. G RT-PCR analysis of GAD67, Dlx2 and GAPDH expression in wild type and Dlx1/2 –/– cells. Lane 1: DNA ladder, 1 kb band is marked. Lane 2: cDNA for GAD67, Dlx2 or GAPDH. Lane 3: wt cultures infected with a control virus. Lane 4: Dlx1/2 –/– cultures infected with a control virus. Lane 5: Dlx1/2 –/– cultures infected with LZRSpBMN–Dlx2 virus.

 
The requirement of Dlx1 and Dlx2 for the development of neocortical GABAergic cells, as well as the co-expression of DLX1 in GABAergic cortical interneurons, suggests that DLX1 and/or DLX2 may directly regulate the GABA phenotype in the neocortex. To test this hypothesis, we constructed a retroviral vector that expresses DLX2 and infected primary cultures of neocortical cells from Dlx1/2 mutants. The results of these experiments are described in this paper.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Virus Production

The LZRSpBMN (Kinsella and Nolan, 1996Go) vector was used to generate a replication incompetent retrovirus encoding full-length mouse DLX2 protein (LZRSpBMN–Dlx2). A EcoRI–NotI fragment, encoding amino acids 1–332 of mouse Dlx2, was cloned into the corresponding sites of LZRSpBMN. The retroviral vector LZRSpBMN–LacZ encoding for 1000 E. coli ß-galactosidase (a gift of G. Nolan, Stanford, CA, USA) was used to produce control virus. Titers of approximately 105–106 gene transducing units/ml were obtained 48 h after calcium phosphate-mediated transfection into Phoenix ecotropic producer cells (Grignani et al., 1998Go). Cells infected with the LZRSpBMN–LacZ virus were assayed using X-gal immunohistochemistry. Cells infected with the LZRSpBMN–Dlx2 virus were assayed using anti-DLX2 immunohistochemistry (Porteus et al., 1994Go).

Ectopic Expression In Vitro

The effects of retrovirally driven expression of Dlx2 were studied in primary cultures of cortex derived from Dlx1/2 –/– E15.5 embryos and their wildtype (wt) littermates. Briefly, embryos resulting from mating between Dlx1/2 –/–heterozygous parents were examined for the presence of cleft palate (which is 100% penetrant in Dlx1/2 –/– mice; Qiu et al., 1997Go). The genotype of each embryo was then confirmed using PCR amplification of genomic DNA as described previously (Anderson et al., 1997aGo). Each brain was processed separately, the pial membrane was removed and neocortical regions corresponding to the presumptive motor and somatosensory cortex were dissected out. Cells were dissociated in 0.01% trypsin and plated on polyornithin/fibronectincoated coverslips at a density of 2 x 105 cells/ml. Two hours after plating, cells were infected with 100 µl of retroviral suspension, containing approximately 104 infectious viral particles. Cells were cultured for 5 days in neurobasal medium (Gibco) containing 10 ng/ml recombinant bFGF.

Sister cultures from wild-type and Dlx1/2 –/– cortices that were infected with a control virus or with LZRSpBMN–Dlx2 virus were analysed for cell proliferation, neuronal differentiation and GABA expression. The number of proliferating cells was evaluated following exposure to 10–5 M BrdU during the last 12 h in vitro as previously described (Cavanagh et al., 1997Go). Differentiating neurons identified by their immunoreactivity with a mouse monoclonal Map2 antiserum (diluted 1:500; Boehringer). GABA expressing cells were revealed using a rabbit polyclonal antiserum (diluted 1:2000; Sigma). The results represent the mean percentage ± SEM of positive cells from three different experiments, in which two coverslips per experimental condition and staining procedure were evaluated. A minimum of 500 cells per coverslipped culture was counted.

RT-PCR

A minimum of 5 x 10 4 wild type or Dlx1/2 –/– cells infected with the LacZ or the Dlx2 retrovirus were harvested in 0.5 ml Triazol (Gibco). Total RNA was extracted following the manufacturer's instructions. The RNA was electrophoresed on a 1.5% agarose gel to assay for degradation. For each RT-PCR reaction, 200 ng of RNA was reverse transcribed using 2 units of AMV-RT (Promega) in the presence of 8 units of RNase inhibitor, 5 nmol of dNTPs and 10 pmol of one of the following sets of primers:

mouse GAD67:

(sense): AAGGCATGGCGGCTGTGCCCAAAC

(antisense): ACCACCCCAGGCAGCATCCACATG

corresponding to nucleotides 817–841 (sense) and nucleotides 1108–1131 (antisense) of a GAD67 cDNA; GenBank accession number Y12257.

mouse Dlx2:

(sense): GGCACCAGTTCGTCTCCGGTCAA

(antisense): CGCCGAAGTCCCAGGATGCTG

corresponding to nucleotides 2985–3007 (sense) and nucleotides 4205–4225 (antisense) of genomic Dlx2; GenBank accession number U51002.

mouse GAPDH:

(sense): GTGGCAAAGTGGAGATTGTTGCC

(antisense): GATGATGACCCGTTTGGCTCC

corresponding to nucleotides 114–136 (sense) and nucleotides 382–404 (antisense) of GAPDH cDNA; GenBank accession number M32599.

Reverse transcription was carried out at 42°C for 45 min. After adding 1 unit of Taq polymerase (Perkin-Elmer-Cetus, Emeryville, CA, USA), mixtures were subjected to the following thermal cycles: 97°C for 2 min, 1 cycle; 97°C for 1 min, 60°C for 1 min, 72°C for 45 s, 20 cycles for GADPH; 25 cycles for Dlx2 and 30 cycles for GAD67. As a positive control, a PCR reaction was carried out with 10 ng of Dlx2, GAPDH or GAD67 cDNAs as templates. Different amounts (1 µg, 500 ng, 250 ng and 125 ng) of total RNA extracted from E15.5 mouse forebrain were used as an indication that the amount of DNA amplified was a function of the starting amount of RNA. Twenty microliters of each individual PCR reaction was electrophoresed on a 1.5% agarose gel; the DNA fragments were stained with ethidium bromide. The predicted sizes of the PCR products were: 314 bp (GAD67); 365 bp (Dlx2); 280 bp (GAPDH). Genomic DNA amplification, which sometimes occurs because of contamination, could be easily differentiated from cDNA amplification by the size of the PCR products. In fact, for each primer pair, the sense and antisense primers were positioned on two different exons. In addition, no PCR amplification was obtained when AMV-RT was omitted from the reaction.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Infection with Recombinant Retroviruses Encoding Dlx2 Leads to DLX2 Expression in Cortical Cells Derived from Dlx1/2 Mutants

Neocortical primary cultures from E15.5 wild-type and Dlx1/2 –/– mice appeared indistinguishable in morphology and density. Cells were infected with recombinant retroviruses within 2 h of being placed in culture and grown for 5 days. Infection with either the LZRSpBMN–LacZ or LZRSpBMN–Dlx2 virus, did not affect the growth or survival of the cells. DLX2 immunoreactive cells were readily detected in non-infected or LZRSpBMN–LacZ virus infected wild-type cortical cultures (roughly 20% of the cells were DLX2 positive; Fig. 3aGo). Cultures derived from Dlx1/2 –/– cortices had no DLX2-immunoreactive cells whether or not they were infected with LZRSpBMN–LacZ (Fig. 3bGo). However, upon infection with LZRSpBMN–Dlx2, DLX2 immunoreactive cells were found in the Dlx1/2 –/– cultures (roughly 5% of the cells; Fig. 3cGo). These DLX2-expressing cells were often observed in clusters of two to eight cells.

Effects of Ectopic Dlx2 Expression on Proliferation, Differentiation and GABA Expression in Wild Type and Dlx1/2–/– Cortical Cells

The number of proliferating cells in cortical cultures derived from wild-type and Dlx1/2 –/– mice was estimated based upon the number of BrdU+ cells after a 12 h exposure to the thymidine analogue. Approximately 73 ± 13% cells were labeled with BrdU in Dlx1/2 –/– cultures, as compared to 76 ± 8% in cultures from wild-type littermates. Infection of Dlx1/2 –/– cultures with LZRSpBMN–Dlx2 did not affect the percentage of proliferating cells (72 ± 8%).

Next, we studied the effect of infection with LZRSpBMN–Dlx2 on differentiation (based on expression of the neuronal marker, MAP2) in the wild-type and Dlx1/2 mutant neocortical cultures. We found no significant difference between various cultures (34 ± 6% of the cells were MAP2 immunoreactive in each case). While this general marker of cortical differentiation was not affected by the Dlx1/2 mutation, there was a marked reduction of GABA+ cells in cortical cultures from Dlx1/2 –/– mice (Fig. 3eGo) compared with cultures from wild type mice (Fig. 3dGo). In all, 19 ± 5% of the wild-type cortical cells were GABA+, whereas only 2 ± 2% cells were GABA+ in Dlx1/2 –/– cortical cells. Upon infection with LZRSpBMN–Dlx2, the number of GABA+ cells in Dlx1/2 –/– cultures increased roughly five-fold, to 11 ± 3% (Fig. 3fGo).

The induction of Dlx2 and GAD expression via infection with the LZRSpBMN–Dlx2 virus was assayed by RT-PCR. Using primers specific for GAD67 and Dlx2, we observed DNA fragments of the expected size from wild type (Fig. 3gGo, lane 3), but not from Dlx1/2 –/– cortical cultures (lane 4). Upon infection of Dlx1/2 –/– cortical cultures with LZRSpBMN–Dlx2, we could now detect expression of both Dlx2 (lane 5), and GAD67 (lane 5) RNA.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lateral and Medial Subcortical-to-cortical Migrations

Herein we have reviewed the evidence that most neocortical interneurons, as observed at birth, arrive to the cortex via tangential migration from the basal telencephalon. There appear to be at least two major sources for these migrating cells: the MGE and the LGE. We suggest that there are at least two distinct ventral-to-dorsal pathways by which subcortical cells reach the cerebral cortex. One is a lateral pathway, in which cells begin their migration in the region of the MGE, pass through the LGE and then enter paleocortex, neocortex and archicortex (Fig. 1aGo). This pathway is greatly reduced or eliminated in the Nkx2.1 mutant mice (Sussel et al., unpublished data); we are presently exploring whether there is a late lateral migration from the LGE that is independent of the MGE.

The second is a medial pathway, in which cells begin their migration in the region of the LGE and septum, and then move to the base of the olfactory bulb. Based upon immunohistochemical studies of GABA expression in both humans and rodents, some of these cells may migrate into the cortical marginal zone and then move along its rostro-caudal dimension (Fig. 1bGo) (Gadisseux et al., 1992Go, Meyer et al. , 1998Go, Lavdas et al., 1999Go). The migration into the olfactory bulb becomes the rostral migratory stream late in gestation and postnatally (Hinds, 1968Go; Luskin, 1993Go). We suggest that both the medial and lateral pathways are disrupted in mice carrying the Dlx1/2 mutation (Anderson et al., 1997bGo; Bulfone et al., 1998Go).

It is interesting that the lateral and medial migratory pathways probably correspond to the well-known axon pathways for the lateral forebrain bundle (internal capsule) and medial forebrain bundle. Perhaps the cells and axons utilize the same molecular signals for following these pathways. In addition, there is a migration in the opposite direction of LHRH+ cells, that originate in the olfactory placode, and then migrate to the preoptic area and hypothalamus (Schwanzel-Fukuda and Pfaff, 1989Go; Wray et al., 1989Go). These cells appear to migrate along transient extensions of axons from the vomeronasal organ that course along the medial ventral telencephalon to the lamina terminalis (Yoshida et al., 1995Go, 1999Go). Thus, the medial cell migration from basal telencephalon to neocortex may follow portions of the same path.

Heterogeneity of Migrating Cell Types

At this point, we have identified several molecular markers of the migrating subcortical cells. Some or all of the cells derived from the MGE initially express Nkx2.1, Lhx6,7, Dlx1,2,5,6, calbindin and GABA. The Nkx2.1+ and Lhx7+ cells appear to stop migrating within the nascent striatum, where, at least in the case of the Nkx2.1+ cells, they may give rise to striatal cholinergic interneurons (Sussel et al., unpublished data, Olsson et al., 1998Go), whereas cells expressing the other markers may continue their migration into the cerebral cortex. Cells in the medial migratory pathway do not express Nkx2.1, Lhx6, or Lhx7, whereas they do express the other markers, such as PBX1 and RU49 (Redmond et al., 1996Go; Yang et al., 1996Go).

Although interneuron precursors appear to migrate into the neocortex from the subcortical telencephalon, it is unclear whether other cortical cell types may also have a subcortical origin. For example, we have not ruled out the possibility that there are cortical projection neurons that are derived from the basal ganglia. Karten has postulated that during evolution of the mammalian cortex there is a migration of projection neurons from specific nuclear subdivisions of the dorsal ventricular ridge to laminar arrangement in the neocortex (Karten, 1969Go, 1997Go). However, since the dorsal ventricular ridge is a cortical structure (Fernandez et al., 1998Go) (L. Puelles et al., unpublished data), and our studies are of subcortical migrations, our findings do not address this hypothesis. In addition, analysis of the neocortex of the Dlx1/2 mutants, which have essentially no detectable basal telencephalic to neocortical migration in slices, does not reveal a reduction of cortical plate thickness or abnormalities in neocortical lamination.

Neocortical glial cells or their progenitors may also have subcortical origins. In the spinal cord, oligodendrocyte precursors are specified in ventral positions, and then migrate dorsally (Miller, 1996Go). Expression of oligodendrocyte markers (e.g. DM20) in ventral locations in the forebrain have led to similar hypotheses (Timsit et al., 1995Go; Spassky et al., 1998Go). Furthermore, it is known that the cortical SVZ is an active site for generation of oligodendrocytes (Levison and Goldman, 1993Go; Luskin et al., 1994). Thus, perhaps the cortical SVZ is seeded by precursors from subcortical sites. Transplantation studies in chick embryos also support this hypothesis (Salvador Martinez, personal communication), as does the finding that the neocortical SVZ is reduced by about 50% in the Dlx1/2 mutants (Anderson and Rubenstein, unpublished data).

A major caveat of the Dlx1/2 and Nkx2.1 mutants is that these animals die on the day of birth. Therefore, we do not know how the reductions in cortical interneurons at P0 reflect development of definitive cortical interneurons and other cell types. We are presently attempting to solve this problem by systematically studying the co-expression of Dlx genes and GABA at various postnatal stages in rodents and ferrets (S. Anderson et al., unpublished data). Evidence suggests that subcortical to neocortical migration is not limited to rodents. A similar migration occurs in ferret slices (S. Anderson et al., unpublished data), and preliminary analysis of DLX2 expression in prenatal human tissue also appears to reveal a stream of cells migrating from the LGE into the neocortex (Kletnic et al., unpublished data).

Genetic Control of Interneuron Specification

Several transcription factors are now candidates for regulating the development of cortical interneurons. Dlx1/2 mutant mice lack most GABAergic cortical cells and virtually all olfactory bulb GABAergic neurons (Anderson et al., 1997aGo, 1997bGo; Bulfone et al., 1998Go). However, these defects may be due to a block in the migration of these cells rather than their specification and differentiation. While we have observed a block in the lateral migratory pathway (Anderson et al., 1997bGo), we have not yet determined whether migration is affected in the medial pathway.

Herein we have provided the first evidence that the DLX2 protein can regulate differentiation of GABAergic cortical neurons (Fig. 3Go). By infecting E15.5 neocortical cells from Dlx1/2 mutants, we found a roughly five-fold increase in GABAergic cells. At this point, we do not know for certain whether all of the induced GABAergic cells are expressing DLX-2 from the virus, or whether some of the GABA+ cells in the mutant cultures were induced by factors secreted from the infected cells. Furthermore, it will be important to determine where DLX2 sits in the hierarchy of GABAergic cell development (specification, differentiation and/or maintenance of GABA phenotype). For instance, our results suggest that DLX proteins can regulate the expression of glutamic acid decarboxylase (GAD), but further studies are needed to confirm a direct regulation of the GAD gene by DLX2.

In addition, the factors that induce expression of the Dlx genes are just beginning to be identified. There is evidence that sonic hedgehog (SHH) can induce Dlx expression (Kohtz et al., 1998Go). SHH is very likely to be one of the primary inductive regulators of a variety of cell types such as cholinergic motor neurons, midbrain dopaminergic neurons and hindbrain serotonergic neurons (Echelard et al., 1993Go; Hynes et al., 1995Go; Ericson et al., 1997Go; Ye et al., 1998Go). Thus, it will interesting to determine whether SHH is required for the generation of GABAergic cells, particularly because these cells form in the basal telencephalon of the Nkx2.1 mutants despite the almost complete lack of telencephalic SHH expression (Sussel et al., unpublished data).

Implications for Human Neuropsychiatric Disorders

Defects in interneuron development and function are implicated in several common brain disorders including the epilepsies and schizophrenias. In the epilepsies, insufficient inhibitory activity predisposes to uncontrolled excitatory discharges. A subset of epilepsies are associated with cortical histological abnormalities, that often have ectopic collections of neurons, which are thought to arise from neuronal migration defects (Flint and Kriegstein, 1997Go). It will be interesting to determine whether there are specific epilepsy syndromes that are caused by disruption of development and/or function of the cells that participate in the subcortical-to-cortical migrations.

The neurobiological bases of the schizophrenias are unknown. Most patients have some symptomatic improvement with medications that inhibit dopamine receptors. Perhaps the most potent of these medications are those that preferentially affect the D4 dopamine receptor (D4R) (e.g. clozapine). D4R is expressed in neocortical interneurons (Mrzljak et al., 1996Go), a brain region that is functionally and possibly histologically abnormal in many schizophrenic patients (Lewis and Anderson, 1995Go; Goldman-Rakic and Selemon 1997Go; Raedler et al., 1998Go). In addition, there is histochemical evidence that neocortical interneurons may be abnormal in subsets of schizophrenic patients (Akbarian et al., 1995Go; Benes et al., 1996Go; Woo et al., 1998Go). We thus suggest that insights into the aetiologies of important human diseases may be garnered by the molecular investigation of the development and function of subcortical cells that migrate to the cerebral cortex.


    Notes
 
This work was supported by the research grants to S.A. from NIMH K08 MH01620-1, to M.M. from the Welcome Trust, ref. 040236, and to J.L.R.R. from Nina Ireland, NARSAD, and NIMH RO1 MH49428-01, RO1 MH51561-01A1 and K02 MH01046-01. Marina Mione is now at: Department of Anatomy and Developmental Biology, University College London, Gower Street, London WC1E 6BT, UK.

Address correspondence to John L.R. Rubenstein, 401 Parnassus Avenue, UCSF San Francisco, CA, 94143–0984, USA. Email: jlrr{at}cgl.ucsf.edu.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Akbarian S, Kim JJ, Potkin SG, Hagman JO, Tafazzoli A, Bunney WE Jr, Jones EG (1995) Gene expression for glutamic acid decarboxylase is reduced without loss of neurons in prefrontal cortex of schizophrenics. Arch Gen Psychiat 52:258–266.[Abstract/Free Full Text]

Anderson SA, Qiu M-S, Bulfone A, Eisenstat DD, Meneses J, Pedersen R, Rubenstein JLR (1997a) Mutations of the homeobox genes Dlx-1 and Dlx-2 disrupt the striatal subventricular zone and differentiation of late-born striatal neurons. Neuron 19:27–37.[Web of Science][Medline]

Anderson SA, Eisenstat DD, Shi L, Rubenstein JLR (1997b) Interneuron migration from basal forebrain to neocortex: dependence on Dlx genes. Science 278:474–476.[Abstract/Free Full Text]

Austin CP, Cepko CL (1990) Cellular migration patterns in the developing mouse cerebral cortex. Development 110:713–732.[Abstract/Free Full Text]

Bagnard D, Lohrum M, Uziel D, Püschel AW, Bolz J (1998) Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections. Development 125:5043–5053.[Abstract]

Benes FM, Vincent SL, Marie A, Khan Y (1996) Up-regulation of GABAA receptor binding on neurons of the prefrontal cortex in schizophrenic subjects. Neuroscience 75:1021–31.[Web of Science][Medline]

Boulder Committee (1970) Embryonic vertebrate central nervous system: revised terminology. Anat Rec 166:257–261.[Medline]

Brunstrom JE, Gray-Swain MR, Osborne PA, Pearlman AL (1997) Neuronal heterotopias in the developing cerebral cortex produced by neurotrophin-4. Neuron 18:505–517.[Web of Science][Medline]

Brunstrom JE, Gray-Swain MR, Pearlman AL (1998) Neurotrophin-4 influences the migration and differentiation of early cortical neurons. In: Axon guidance and neural plasticity, p. 36. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory.

Bulfone A, Wang F, Hevner R. Anderson S, Cutforth T, Chen S, Meneses J, Pedersen R, Axel R, Rubenstein JL (1998) An olfactory sensory map develops in the absence of normal projection neurons or GABAergic interneurons. Neuron 21:1273–1282.[Web of Science][Medline]

Cavanagh JF, Mione MC, Pappas IS, Parnavelas JG (1997) Basic fibroblast growth factor prolongs the proliferation of rat cortical progenitor cells in vitro without altering their cell cycle parameters. Cereb Cortex 7:293–302.[Abstract/Free Full Text]

de Carlos JA, Lopez-Mascaraque L, Valverde F (1996) Dynamics of cell migration from the lateral ganglionic eminence in the rat. J Neurosci 16:6146–6156.[Abstract/Free Full Text]

Deacon TW, Pakzaban P, Isacson O (1994) The lateral ganglionic eminence is the origin of cells committed to striatal phenotypes: neural transplantation and developmental evidence. Brain Res 668: 211–219.[Web of Science][Medline]

DeDiego I, Smith-Fernandez A, Fairen A (1994) Cortical cells that migrate beyond area boundaries: characterization of an early neuronal population in the lower intermediate zone of prenatal rats. Eur J Neurosci 6:983–997.[Web of Science][Medline]

Del Rio JA, Soriano E, Ferrer I (1992) Development of GABA-immunoreactivity in the neocortex of the mouse. J Comp Neurol 326:501–526.[Web of Science][Medline]

Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP (1993) Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75:1417–430.[Web of Science][Medline]

Ericson J, Rashbass P, Schedl A, Brenner-Morton S, Kawakami A, van Heyningen V, Jessell TM, Briscoe J (1997) Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell 90:169–180.[Web of Science][Medline]

Fernandez AS, Pieau C, Repérant J, Boncinelli E, Wassef M (1998) Expression of the Emx-1 and Dlx-1 homeobox genes define three molecularly distinct domains in the telencephalon of mouse, chick, turtle and frog embryos: implications for the evolution of telencephalic subdivisions in amniotes. Development 125:2099–2111.[Abstract]

Fishell G, Mason CA, Hatten ME (1993) Dispersion of neural progenitors within the germinal zones of the forebrain. Nature 362:636–638.[Medline]

Flint AC, Kriegstein AR (1997) Mechanisms underlying neuronal migration disorders and epilepsy. Curr Opin Neurol 10:92–97.[Web of Science][Medline]

Gadisseux JF, Goffinet AM, Lyon G, Evrard P (1992) The human transient subpial granular layer: an optical, immunohistochemical and ultra-structural analysis. J Comp Neurol 324:94–114.[Web of Science][Medline]

Golden JA, Zitz JC, McFadden K Cepko CL (1997) Cell migration in the developing chick diencephalon. Development 124:3525–3533.[Abstract]

Goldman-Rakic PS, Selemon LD (1997) Functional and anatomical aspects of prefrontal pathology in schizophrenia [see comments]. Schizophr Bull 23:437–458.

Gray GE, Leber SM, Sanes JR (1990) Migratory patterns of clonally related cells in the developing central nervous system. Experientia 46: 929–940.[Web of Science][Medline]

Grignani F, Kinsella T, Mencarelli A, Valtieri M, Riganelli D, Lanfrancone L, Peschle C, Nolan GP, Pelicci P.G. (1998) High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein. Cancer Res 58:14–19.[Abstract/Free Full Text]

Hendry SH, Schwark HD, Jones EG, Yan J (1987) Numbers and proportions of GABA-immunoreactive neurons in different areas of monkey cerebral cortex. J Neurosci 7:1503–1519.[Abstract]

Hinds JW (1968) Autoradiographic study of histogenesis in the mouse olfactory bulb. II. Cell proliferation and migration. J Comp Neurol 134:305–322.[Web of Science][Medline]

Hu H, Rutishauser U (1996) A septum-derived chemorepulsive factor for migrating olfactory interneuron precursors. Neuron 16:933–940.[Web of Science][Medline]

Hu H, Tomasiewicz H, Magnuson T, Rutishauser U (1996) The role of polysialic acid in migration of olfactory bulb interneuron precursors in the subventricular zone. Neuron 16:735–743.[Web of Science][Medline]

Hynes M, Porter JA, Chiang C, Chang D, Tessier-Lavigne M, Beachy PA, Rosenthal A (1995) Induction of midbrain dopaminergic neurons by sonic hedgehog. Neuron 15:35–44.[Web of Science][Medline]

Karten HJ (1969) The origin of the avian telencephalon and some speculations on the phylogeny of the amniote telencephalon. Ann N Y Acad Sci 167:164–179.[Web of Science]

Karten HJ (1997) Evolutionary developmental biology meets the brain: the origins of mammalian cortex [comment]. Proc Natl Acad Sci USA 94:2800–2804.[Free Full Text]

Kennedy TE, Serafini T, de la Torre JR, Tessier-Lavigne M (1994) Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord. Cell 78:425–435.[Web of Science][Medline]

Kinsella TM, Nolan GP (1996) Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther 7:1405–1413.[Web of Science][Medline]

Kohtz JD, Baker DP, Corte G, Fishell G (1998) Regionalization within the mammalian telencephalon is mediated by changes in responsiveness to sonic hedgehog. Development 125:5079–5089.[Abstract]

Kolodkin AL, Matthes DJ, Goodman CS (1993) The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell 75:1389–1399.[Web of Science][Medline]

Kornack DR, Rakic P (1995) Radial and horizontal deployment of clonally related cells in the primate neocortex: relationship to distinct mitotic lineages. Neuron 15:311–321.[Web of Science][Medline]

Lavdas AA, Grigoriou M, Pachnis V, Parnavelas JG (1999) The medial ganglionic eminence gives rise to a population of early neurons in the developing cerebral cortex. J Neurosci (in press).

Levison SW, Goldman JE (1993) Both oligodendrocytes and astrocytes develop from progenitors in the subventricular zone of postnatal rat forebrain. Neuron 10:201–212.[Web of Science][Medline]

Lewis DA, Anderson SA (1995) The functional architecture of the prefrontal cortex and schizophrenia. Psychol Med 25:887–894.[Web of Science][Medline]

Lois C, Alvarez-Buylla A (1994) Long-distance neuronal migration in the adult mammalian brain. Science 264:1145–1148.[Abstract/Free Full Text]

Lois C, Garcia-Verdugo JM, Alvarez-Buylla A (1996) Chain migration of neuronal precursors. Science 271:978–981.[Abstract]

Luskin MB (1993) Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone. Neuron 11:173–189.[Web of Science][Medline]

Luskin MB, McDermott K (1994) Divergent lineages for oligodendrocytes and astrocytes originating in the neonatal forebrain subventricular zone. Glia 11:211–226.[Web of Science][Medline]

Luskin MB, Pearlman AL, Sanes JR (1988) Cell lineage in the cerebral cortex of the mouse studied in vivo and in vitro with a recombinant retrovirus. Neuron 1:635–647.[Web of Science][Medline]

Meinecke DL, Peters A (1987) GABA immunoreactive neurons in rat visual cortex. J Comp Neurol 261:388–404.[Web of Science][Medline]

Métin C (1998) Guidance of early cortical axons in mammals. In: Laboratory-axon guidance and synaptic plasticity, p. 137. Cold Spring Harbor, meeting abstract.

Métin C, Godement P (1996) The ganglionic eminence may be an intermediate target for corticofugal and thalamocortical axons. J Neurosci 16:3219–3235.[Abstract/Free Full Text]

Métin C, Deléglise D, Serafini T, Kennedy TE, Tessier-Lavigne M (1997) A role for netrin-1 in the guidance of cortical efferents. Development 124:5063–5074.[Abstract]

Meyer G, Soria JM, Martínez-Galán JR, Martín-Clemente B, Fairén A (1998) Different origins and developmental histories of transient neurons in the marginal zone of the fetal and neonatal rat cortex. J Comp Neurol 397:493–518.[Web of Science][Medline]

Miller RH (1996) Oligodendrocyte origins. Trends Neurosci 19:92–96.[Web of Science][Medline]

Mione MC, Cavanagh JFR, Harris B, Parnavelas JG (1997) Cell fate specification and symmetrical/asymmetrical divisions in the developing cerebral cortex. J Neurosci 17:2018–2029.[Abstract/Free Full Text]

Misson JP, Austin CP, Takahashi T, Cepko CL, Caviness VS Jr (1991) The alignment of migrating neural cells in relation to the murine neopallial radial glial fiber system. Cereb Cortex 1:221–229.[Abstract/Free Full Text]

Mrzljak L, Bergson C, Pappy M, Huff R, Levenson R, Goldman-Rakic PS (1996) Localization of dopamine D4 receptors in GABAergic neurons of the primate brain. Nature 381:245–248.[Medline]

Olsson M, Campbell K, Wictorin K, Björklund A (1995) Projection neurons in fetal striatal transplants are predominantly derived from the lateral ganglionic eminence. Neuroscience 69:1169–1182.[Web of Science][Medline]

Olsson M, Björklund A, Campbell K (1998) Early specification of striatal projection neurons and interneuronal subtypes in the lateral and medial ganglionic eminence. Neuroscience 84:867–876.[Web of Science][Medline]

O'Rourke NA, Dailey ME, Smith SJ, McConnell SK (1992) Diverse migratory pathways in the developing cerebral cortex. Science 258:299–302.[Abstract/Free Full Text]

O'Rourke NA, Sullivan DP, Kaznowski CE, Jacobs AA, McConnell SK (1995) Tangential migration of neurons in the developing cerebral cortex. Development 121:2165–2176.[Abstract]

Parnavelas JG, Lieberman AR, Webster KE (1977) Organization of neurons in the visual cortex, area 17, of the rat. J Anat 124:305–322.[Web of Science][Medline]

Porteus MH, Bulfone A, Liu JK, Lo LC, Rubenstein JLR (1994) DLX-2, MASH-1 and MAP-2 expression and bromodeoxyuridine incorporation define molecularly distinct cell populations in the embryonic mouse forebrain. J Neurosci 44:6370–6383.

Price J, Thurlow L (1988) Cell lineage in the rat cerebral cortex: a study using retroviral-mediated gene transfer. Development 104:473–482.[Abstract/Free Full Text]

Püschel AW, Adams RH, Betz H (1995) Murine semaphorin D/collapsin is a member of a diverse gene family and creates domains inhibitory for axonal extension. Neuron 14:941–948.[Web of Science][Medline]

Qiu M, Bulfone A, Ghattas I, Meneses JJ, Christensen L, Sharpe PT, Presley R, Pedersen RA, Rubenstein JLR (1997) Role of the Dlx homeobox genes in proximodistal patterning of the branchial arches: mutations of Dlx-1, Dlx-2 and Dlx-1 and -2 alter morphogenesis of proximal skeletal and soft tissue structures derived from the first and second arches. Dev Biol 185:165–184.[Web of Science][Medline]

Raedler TJ, Knable MB, Weinberger DR (1998) Schizophrenia as a developmental disorder of the cerebral cortex. Curr Opin Neurobiol 8:157–161.[Web of Science][Medline]

Rakic P (1972) Mode of cell migration to the superficial layers of fetal monkey neocortex. J Comp Neurol 145:61–83.[Web of Science][Medline]

Rakic P (1985) Contact regulation of neuronal migration. In: The cell in contact (Edelman GM, Thiery JP, eds), pp. 67–91. New York: Wiley.

Rakic P (1988) Specification of cerebral cortical areas. Science 241: 170–176.[Abstract/Free Full Text]

Redmond L, Hockfield S, Morabito MA (1996) The divergent homeobox gene PBX1 is expressed in the postnatal subventricular zone and interneurons of the olfactory bulb. J Neurosci 16:2972–2982.[Abstract/Free Full Text]

Schwanzel-Fukuda M, Pfaff DW (1989) Origin of luteinizing hormone releasing hormone neurons. Nature 338:161–164.[Medline]

Serafini T, Colamarino SA, Leonardo ED, Wang H, Beddington R, Skarnes WC, Tessier-Lavigne M (1996) Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system. Cell 87:1001–1014.[Web of Science][Medline]

Sheth AN, McKee ML, Bhide PG (1998) The sequence of formation and development of corticostriate connections in mice. Dev Neurosci 20:98–112.[Web of Science][Medline]

Spassky N, Goujet-Zalc C, Parmantier E, Olivier C, Martinez S, Ivanova A, Ikenaka K, Macklin W, Cerruti I, Zalc B, Thomas JL (1998) Multiple restricted origin of oligodendrocytes. J Neurosci 18:8331–8343.[Abstract/Free Full Text]

Tamamaki N, Fujimori E, Takauji R (1997) Origin and route of tangentially migrating neurons in the developing neocortical intermediate zone. J Neurosci 17:8313–8323.[Abstract/Free Full Text]

Tan SS, Breen S (1993) Radial mosaicism and tangential cell dispersion both contribute to mouse neocortical development. Nature 362: 638–640.[Medline]

Tan SS, Kalloniatis M, Sturm K, Tam PP, Reese BE, Faulkner-Jones B (1998) Separate progenitors for radial and tangential cell dispersion during development of the cerebral neocortex. Neuron 21:295–304.[Web of Science][Medline]

Timsit S, Martinez S, Allinquant B, Peyron F, Puelles L, Zalc B (1995) Oligodendrocytes originate in a restricted zone of the embryonic ventral neural tube defined by DM-20 mRNA expression. J Neurosci 15:1012–1024.[Abstract]

Tomasiewicz H, Ono K, Yee D, Thompson C, Goridis C, Rutishauser U, Magnuson T (1993) Genetic deletion of a neural cell adhesion molecule variant (N-CAM-180) produces distinct defects in the central nervous system. Neuron 11:1163–1174.[Web of Science][Medline]

Van Eden CG, Mrzljak L, Voorn P, Uylings HBM (1989) Prenatal development of GABA-ergic neurons in the neocortex of the rat. J Comp Neurol 289:213–227.[Web of Science][Medline]

Walsh C, Cepko CL (1988) Clonally related cortical cells show several migration patterns. Science 241:1342–1345.[Abstract/Free Full Text]

Woo TU, Whitehead RE, Melchitzky DS, Lewis DA (1998) A subclass of prefrontal gamma-aminobutyric acid axon terminals are selectively altered in schizophrenia. Proc Natl Acad Sci USA 95:5341–5346.[Abstract/Free Full Text]

Wray S, Nieburgs A, Elkabes S (1989) Spatiotemporal cell expression of luteinizing hormone-releasing hormone in the prenatal mouse: evidence for an embryonic origin in the olfactory placode. Brain Res Dev Brain Res 46:309–318.[Medline]

Yang XW, Zhong R, Heintz N (1996) Granule cell specification in the developing mouse brain as defined by expression of the zinc finger transcription factor RU49. Development 122:555–566.[Abstract]

Ye W, Shimamura K, Rubenstein JL, Hynes MA, Rosenthal A (1998) FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 93:755–766.[Web of Science][Medline]

Yoshida K, Tobet SA, Crandall JE, Jimenez TP, Schwarting GA (1995) The migration of luteinizing hormone-releasing hormone neurons in the developing rat is associated with a transient, caudal projection of the vomeronasal nerve. J Neurosci 15:7769–7777.[Abstract]

Yoshida K, Rutishauser U, Crandall JE, Schwarting GA (1999) Polysialic acid facilitates migration of luteinizing hormone-releasing hormone neurons on vomeronasal axons. J Neurosci 19:794–801.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cereb CortexHome page
E. G. Jones
The Origins of Cortical Interneurons: Mouse versus Monkey and Human
Cereb Cortex, September 1, 2009; 19(9): 1953 - 1956.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
A. R. Moore, R. Filipovic, Z. Mo, M. N. Rasband, N. Zecevic, and S. D. Antic
Electrical Excitability of Early Neurons in the Human Cerebral Cortex during the Second Trimester of Gestation
Cereb Cortex, August 1, 2009; 19(8): 1795 - 1805.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
J. E. Long, I. Cobos, G. B. Potter, and J. L. R. Rubenstein
Dlx1 and Mash1 Transcription Factors Control MGE and CGE Patterning and Differentiation through Parallel and Overlapping Pathways
Cereb Cortex, July 1, 2009; 19(suppl_1): i96 - i106.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
Z. Petanjek, B. Berger, and M. Esclapez
Origins of Cortical GABAergic Neurons in the Cynomolgus Monkey
Cereb Cortex, February 1, 2009; 19(2): 249 - 262.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. T. Fulp, G. Cho, E. D. Marsh, I. M. Nasrallah, P. A. Labosky, and J. A. Golden
Identification of Arx transcriptional targets in the developing basal forebrain
Hum. Mol. Genet., December 1, 2008; 17(23): 3740 - 3760.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
G. Friocourt, S. Kanatani, H. Tabata, M. Yozu, T. Takahashi, M. Antypa, O. Raguenes, J. Chelly, C. Ferec, K. Nakajima, et al.
Cell-Autonomous Roles of ARX in Cell Proliferation and Neuronal Migration during Corticogenesis
J. Neurosci., May 28, 2008; 28(22): 5794 - 5805.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
V. C. Cuzon, P. W. L. Yeh, Y. Yanagawa, K. Obata, and H. H. Yeh
Ethanol Consumption during Early Pregnancy Alters the Disposition of Tangentially Migrating GABAergic Interneurons in the Fetal Cortex
J. Neurosci., February 20, 2008; 28(8): 1854 - 1864.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
S. Poluch, B. Jablonska, and S. L. Juliano
Alteration of Interneuron Migration in a Ferret Model of Cortical Dysplasia
Cereb Cortex, January 1, 2008; 18(1): 78 - 92.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
A. Mingorance-Le Meur, B. Zheng, E. Soriano, and J. A. del Rio
Involvement of the Myelin-Associated Inhibitor Nogo-A in Early Cortical Development and Neuronal Maturation
Cereb Cortex, October 1, 2007; 17(10): 2375 - 2386.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. R. Romito-DiGiacomo, H. Menegay, S. A. Cicero, and K. Herrup
Effects of Alzheimer's Disease on Different Cortical Layers: The Role of Intrinsic Differences in A{beta} Susceptibility
J. Neurosci., August 8, 2007; 27(32): 8496 - 8504.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
B. Berninger, M. R. Costa, U. Koch, T. Schroeder, B. Sutor, B. Grothe, and M. Gotz
Functional Properties of Neurons Derived from In Vitro Reprogrammed Postnatal Astroglia
J. Neurosci., August 8, 2007; 27(32): 8654 - 8664.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. Chittajallu, A. Kunze, J.-M. Mangin, and V. Gallo
Differential Synaptic Integration of Interneurons in the Outer and Inner Molecular Layers of the Developing Dentate Gyrus
J. Neurosci., August 1, 2007; 27(31): 8219 - 8225.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. N. Le, G. Du, M. Fonseca, Q.-P. Zhou, J. T. Wigle, and D. D. Eisenstat
Dlx Homeobox Genes Promote Cortical Interneuron Migration from the Basal Forebrain by Direct Repression of the Semaphorin Receptor Neuropilin-2
J. Biol. Chem., June 29, 2007; 282(26): 19071 - 19081.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Kohwi, M. A. Petryniak, J. E. Long, M. Ekker, K. Obata, Y. Yanagawa, J. L. R. Rubenstein, and A. Alvarez-Buylla
A Subpopulation of Olfactory Bulb GABAergic Interneurons Is Derived from Emx1- and Dlx5/6-Expressing Progenitors
J. Neurosci., June 27, 2007; 27(26): 6878 - 6891.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Menuet, A. Alunni, J.-S. Joly, W. R. Jeffery, and S. Retaux
Expanded expression of Sonic Hedgehog in Astyanax cavefish: multiple consequences on forebrain development and evolution
Development, March 1, 2007; 134(5): 845 - 855.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
V. C. Cuzon, P. W. Yeh, Q. Cheng, and H. H. Yeh
Ambient GABA Promotes Cortical Entry of Tangentially Migrating Cells Derived from the Medial Ganglionic Eminence
Cereb Cortex, October 1, 2006; 16(10): 1377 - 1388.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
R. L. Ramos, J. Bai, and J. J. LoTurco
Heterotopia Formation in Rat but Not Mouse Neocortex after RNA Interference Knockdown of DCX
Cereb Cortex, September 1, 2006; 16(9): 1323 - 1331.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Q. Ma
Transcriptional regulation of neuronal phenotype in mammals
J. Physiol., September 1, 2006; 575(2): 379 - 387.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. K. Goetz, B. Scheffler, H.-X. Chen, S. Wang, O. Suslov, H. Xiang, O. Brustle, S. N. Roper, and D. A. Steindler
Temporally restricted substrate interactions direct fate and specification of neural precursors derived from embryonic stem cells
PNAS, July 18, 2006; 103(29): 11063 - 11068.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
T. Takahata, Y. Komatsu, A. Watakabe, T. Hashikawa, S. Tochitani, and T. Yamamori
Activity-dependent Expression of occ1 in Excitatory Neurons Is a Characteristic Feature of the Primate Visual Cortex
Cereb Cortex, July 1, 2006; 16(7): 929 - 940.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
W. Andrews, A. Liapi, C. Plachez, L. Camurri, J. Zhang, S. Mori, F. Murakami, J. G. Parnavelas, V. Sundaresan, and L. J. Richards
Robo1 regulates the development of major axon tracts and interneuron migration in the forebrain
Development, June 1, 2006; 133(11): 2243 - 2252.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
M. C. Moe, M. Varghese, A. I. Danilov, U. Westerlund, J. Ramm-Pettersen, L. Brundin, M. Svensson, J. Berg-Johnsen, and I. A. Langmoen
Multipotent progenitor cells from the adult human brain: neurophysiological differentiation to mature neurons
Brain, September 1, 2005; 128(9): 2189 - 2199.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Kohwi, N. Osumi, J. L. R. Rubenstein, and A. Alvarez-Buylla
Pax6 Is Required for Making Specific Subpopulations of Granule and Periglomerular Neurons in the Olfactory Bulb
J. Neurosci., July 27, 2005; 25(30): 6997 - 7003.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
C. Wonders and S. A. Anderson
Cortical Interneurons and Their Origins
Neuroscientist, June 1, 2005; 11(3): 199 - 205.
[Abstract] [PDF]


Home page
J Child NeurolHome page
M. F. McManus and J. A. Golden
Topical Review: Neuronal Migration in Developmental Disorders
J Child Neurol, April 1, 2005; 20(4): 280 - 286.
[Abstract] [PDF]


Home page
Cereb CortexHome page
C. Zimmer, M.-C. Tiveron, R. Bodmer, and H. Cremer
Dynamics of Cux2 Expression Suggests that an Early Pool of SVZ Precursors is Fated to Become Upper Cortical Layer Neurons
Cereb Cortex, December 1, 2004; 14(12): 1408 - 1420.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. D. Hodge, A. J. D'Ercole, and J. R. O'Kusky
Insulin-Like Growth Factor-I Accelerates the Cell Cycle by Decreasing G1 Phase Length and Increases Cell Cycle Reentry in the Embryonic Cerebral Cortex
J. Neurosci., November 10, 2004; 24(45): 10201 - 10210.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
I. M. Nasrallah, J. C. Minarcik, and J. A. Golden
A polyalanine tract expansion in Arx forms intranuclear inclusions and results in increased cell death
J. Cell Biol., November 8, 2004; 167(3): 411 - 416.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
G. Lopez-Bendito, K. Sturgess, F. Erdelyi, G. Szabo, Z. Molnar, and O. Paulsen
Preferential Origin and Layer Destination of GAD65-GFP Cortical Interneurons
Cereb Cortex, October 1, 2004; 14(10): 1122 - 1133.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
P. Taglialatela, J. M. Soria, V. Caironi, A. Moiana, and S. Bertuzzi
Compromised generation of GABAergic interneurons in the brains of Vax1-/- mice
Development, September 1, 2004; 131(17): 4239 - 4249.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
J. E. Crandall, H. E. Hackett, S. A. Tobet, B. E. Kosofsky, and P. G. Bhide
Cocaine Exposure Decreases GABA Neuron Migration from the Ganglionic Eminence to the Cerebral Cortex in Embryonic Mice
Cereb Cortex, June 1, 2004; 14(6): 665 - 675.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
F. Moya and M. Valdeolmillos
Polarized Increase of Calcium and Nucleokinesis in Tangentially Migrating Neurons
Cereb Cortex, June 1, 2004; 14(6): 610 - 618.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Q. Xu, I. Cobos, E. De La Cruz, J. L. Rubenstein, and S. A. Anderson
Origins of Cortical Interneuron Subtypes
J. Neurosci., March 17, 2004; 24(11): 2612 - 2622.
[Abstract] [Full Text] [PDF]


Home page
J Child NeurolHome page
M. F. McManus and J. A. Golden
Topical Review: Neuronal Migration in Developmental Disorders
J Child Neurol, March 1, 2004; 19(3): 280 - 286.
[Abstract] [PDF]


Home page
DevelopmentHome page
T. Nomura and N. Osumi
Misrouting of mitral cell progenitors in the Pax6/small eyerat telencephalon
Development, February 15, 2004; 131(4): 787 - 796.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. Tanaka, Y. Nakaya, Y. Yanagawa, K. Obata, and F. Murakami
Multimodal tangential migration of neocortical GABAergic neurons independent of GPI-anchored proteins
Development, December 1, 2003; 130(23): 5803 - 5813.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Gulacsi and L. Lillien
Sonic Hedgehog and Bone Morphogenetic Protein Regulate Interneuron Development from Dorsal Telencephalic Progenitors In Vitro
J. Neurosci., October 29, 2003; 23(30): 9862 - 9872.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
S. Rakic and N. Zecevic
Emerging Complexity of Layer I in Human Cerebral Cortex
Cereb Cortex, October 1, 2003; 13(10): 1072 - 1083.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
S. Nery, J. G. Corbin, and G. Fishell
Dlx2 Progenitor Migration in Wild Type and Nkx2.1 Mutant Telencephalon
Cereb Cortex, September 1, 2003; 13(9): 895 - 903.
[Abstract] [Full Text] [PDF]


Home page
Arch Gen PsychiatryHome page
M. Kromkamp, H. B. M. Uylings, M. P. Smidt, A. J. C. G. M. Hellemons, J. P. H. Burbach, and R. S. Kahn
Decreased Thalamic Expression of the Homeobox Gene DLX1 in Psychosis
Arch Gen Psychiatry, September 1, 2003; 60(9): 869 - 874.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H. Valcanis and S.-S. Tan
Layer Specification of Transplanted Interneurons in Developing Mouse Neocortex
J. Neurosci., June 15, 2003; 23(12): 5113 - 5122.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
A. D. Tramontin, J. M. Garcia-Verdugo, D. A. Lim, and A. Alvarez-Buylla
Postnatal Development of Radial Glia and the Ventricular Zone (VZ): a Continuum of the Neural Stem Cell Compartment
Cereb Cortex, June 1, 2003; 13(6): 580 - 587.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
Q. Xu, E. de la Cruz, and S. A. Anderson
Cortical Interneuron Fate Determination: Diverse Sources for Distinct Subtypes?
Cereb Cortex, June 1, 2003; 13(6): 670 - 676.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
O. Marin, A. S. Plump, N. Flames, C. Sanchez-Camacho, M. Tessier-Lavigne, and J. L. R. Rubenstein
Directional guidance of interneuron migration to the cerebral cortex relies on subcortical Slit1/2-independent repulsion and cortical attraction
Development, May 1, 2003; 130(9): 1889 - 1901.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
H. L. Picken Bahrey and W. J. Moody
Early Development of Voltage-Gated Ion Currents and Firing Properties in Neurons of the Mouse Cerebral Cortex
J Neurophysiol, April 1, 2003; 89(4): 1761 - 1773.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Shinozaki, T. Miyagi, M. Yoshida, T. Miyata, M. Ogawa, S. Aizawa, and Y. Suda
Absence of Cajal-Retzius cells and subplate neurons associated with defects of tangential cell migration from ganglionic eminence in Emx1/2 double mutant cerebral cortex
Development, March 9, 2003; 129(14): 3479 - 3492.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
H. L. P. Bahrey and W. J. Moody
Voltage-gated Currents, Dye and Electrical Coupling in the Embryonic Mouse Neocortex
Cereb Cortex, March 1, 2003; 13(3): 239 - 251.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
A. Bellion, M. Wassef, and C. Metin
Early Differences in Axonal Outgrowth, Cell Migration and GABAergic Differentiation Properties between the Dorsal and Lateral Cortex
Cereb Cortex, February 1, 2003; 13(2): 203 - 214.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Wichterle, M. Alvarez-Dolado, L. Erskine, and A. Alvarez-Buylla
Permissive corridor and diffusible gradients direct medial ganglionic eminence cell migration to the neocortex
PNAS, January 21, 2003; 100(2): 727 - 732.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
J.M. Soria and M. Valdeolmillos
Receptor-activated Calcium Signals in Tangentially Migrating Cortical Cells
Cereb Cortex, August 1, 2002; 12(8): 831 - 839.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
S. A. Anderson, C. E. Kaznowski, C. Horn, J. L.R. Rubenstein, and S. K. McConnell
Distinct Origins of Neocortical Projection Neurons and Interneurons In Vivo
Cereb Cortex, July 1, 2002; 12(7): 702 - 709.
[Abstract] [Full Text] [PDF]


Home page
Chem SensesHome page
S. A. Anderson
Determination of Cell Fate within the Telencephalon
Chem Senses, July 1, 2002; 27(6): 573 - 575.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C. B. Reid and C. A. Walsh
Evidence of Common Progenitors and Patterns of Dispersion in Rat Striatum and Cerebral Cortex
J. Neurosci., May 15, 2002; 22(10): 4002 - 4014.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. C. Noctor, A. C. Flint, T. A. Weissman, W. S. Wong, B. K. Clinton, and A. R. Kriegstein
Dividing Precursor Cells of the Embryonic Cortical Ventricular Zone Have Morphological and Molecular Characteristics of Radial Glia
J. Neurosci., April 15, 2002; 22(8): 3161 - 3173.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
B. E. Porter, A. Brooks-Kayal, and J. A. Golden
Disorders of Cortical Development and Epilepsy
Arch Neurol, March 1, 2002; 59(3): 361 - 365.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
G. Panganiban and J. L. R. Rubenstein
Developmental functions of the Distal-less/Dlx homeobox genes
Development, January 10, 2002; 129(19): 4371 - 4386.
[Abstract] [Full Text] [PDF]


Home page
Cereb CortexHome page
T. Stuhmer, L. Puelles, M. Ekker, and J. L.R. Rubenstein
Expression from a Dlx Gene Enhancer Marks Adult Mouse Cortical GABAergic Neurons
Cereb Cortex, January 1, 2002; 12(1): 75 - 85.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
T. Stuhmer, S. A. Anderson, M. Ekker, and J. L. R. Rubenstein
Ectopic expression of the Dlx genes induces glutamic acid decarboxylase and Dlx expression
Development, January 1, 2002; 129(1): 245 - 252.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Toresson and K. Campbell
A role for Gsh1 in the developing striatum and olfactory bulb of Gsh2 mutant mice
Development, December 1, 2001; 128(23): 4769 - 4780.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Voigt, T. Opitz, and A. D. de Lima
Synchronous Oscillatory Activity in Immature Cortical Network Is Driven by GABAergic Preplate Neurons
J. Neurosci., November 15, 2001; 21(22): 8895 - 8905.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Denaxa, C.-H. Chan, M. Schachner, J. G. Parnavelas, and D. Karagogeos
The adhesion molecule TAG-1 mediates the migration of cortical interneurons from the ganglionic eminence along the corticofugal fiber system
Development, November 15, 2001; 128(22): 4635 - 4644.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
M. P. Jacobs, G. D. Fischbach, M. R. Davis, M. A. Dichter, R. Dingledine, D. H. Lowenstein, M. J. Morrell, J. L. Noebels, M. A. Rogawski, S. S. Spencer, et al.
Future directions for epilepsy research
Neurology, November 13, 2001; 57(9): 1536 - 1542.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
H. Baker, N. Liu, H. S. Chun, S. Saino, R. Berlin, B. Volpe, and J. H. Son
Phenotypic Differentiation during Migration of Dopaminergic Progenitor Cells to the Olfactory Bulb
J. Neurosci., November 1, 2001; 21(21): 8505 - 8513.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Wichterle, D. H. Turnbull, S. Nery, G. Fishell, and A. Alvarez-Buylla
In utero fate mapping reveals distinct migratory pathways and fates of neurons born in the mammalian basal forebrain
Development, October 1, 2001; 128(19): 3759 - 3771.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. McCarthy, D. H. Turnbull, C. A. Walsh, and G. Fishell
Telencephalic Neural Progenitors Appear To Be Restricted to Regional and Glial Fates before the Onset of Neurogenesis
J. Neurosci., September 1, 2001; 21(17): 6772 - 6781.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
O. Marin, A. Yaron, A. Bagri, M. Tessier-Lavigne, and J. L. R. Rubenstein
Sorting of Striatal and Cortical Interneurons Regulated by Semaphorin-Neuropilin Interactions
Science, August 3, 2001; 293(5531): 872 - 875.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
G. Meyer
Book Review: Human Neocortical Development: The Importance of Embryonic and Early Fetal Events
Neuroscientist, August 1, 2001; 7(4): 303 - 314.
[Abstract] [PDF]


Home page
Cereb CortexHome page
M. R. Sarkisian, M. Frenkel, W. Li, J. A. Oborski, and J. J. LoTurco
Altered Interneuron Development in the Cerebral Cortex of the Flathead Mutant
Cereb Cortex, August 1, 2001; 11(8): 734 - 743.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. Zecevic and P. Rakic
Development of Layer I Neurons in the Primate Cerebral Cortex
J. Neurosci., August 1, 2001; 21(15): 5607 - 5619.
[Abstract] [Full Text] [PDF]


Home page
Am. J. PsychiatryHome page
D. W. Volk, M. C. Austin, J. N. Pierri, A. R. Sampson, and D. A. Lewis
GABA Transporter-1 mRNA in the Prefrontal Cortex in Schizophrenia: Decreased Expression in a Subset of Neurons
Am J Psychiatry, February 1, 2001; 158(2): 256 - 265.
[Abstract] [Full Text]


Home page
DevelopmentHome page
S Nery, H Wichterle, and G Fishell
Sonic hedgehog contributes to oligodendrocyte specification in the mammalian forebrain
Development, January 2, 2001; 128(4): 527 - 540.
[Abstract] [PDF]


Home page
DevelopmentHome page
K Yun, S Potter, and J. Rubenstein
Gsh2 and Pax6 play complementary roles in dorsoventral patterning of the mammalian telencephalon
Development, January 1, 2001; 128(2): 193 - 205.
[Abstract] [PDF]


Home page
J. Neurosci.Home page
W. J. Zhu and S. N. Roper
Reduced Inhibition in an Animal Model of Cortical Dysplasia
J. Neurosci., December 1, 2000; 20(23): 8925 - 8931.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
O. Marin, S. A. Anderson, and J. L. R. Rubenstein
Origin and Molecular Specification of Striatal Interneurons
J. Neurosci., August 15, 2000; 20(16): 6063 - 6076.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Corbin, N Gaiano, R. Machold, A Langston, and G Fishell
The Gsh2 homeodomain gene controls multiple aspects of telencephalic development
Development, January 12, 2000; 127(23): 5007 - 5020.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (185)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Anderson, S.
Right arrow Articles by Rubenstein, J. L.R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anderson, S.
Right arrow Articles by Rubenstein, J. L.R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?