Cerebral Cortex, Vol. 9, No. 6, 601-610,
September 1999
© 1999 Oxford University Press
Regional Differences in the Developing Cerebral Cortex Revealed by Ephrin-A5 Expression
Department of Biological Sciences, Stanford University, Stanford, California and , 1 Department of Neuroscience, Genentech, Inc., South San Francisco, California, USA
| Abstract |
|---|
|
|
|---|
The development of axonal connections between thalamic nuclei and their cortical target areas occurs in a highly specific manner. To explore the mechanisms of thalamocortical axon pathfinding, we investigated the expression of several members of the ephrin and Eph gene families in the forebrain. The Eph ligand ephrin-A5 was expressed in three distinct gradients during the development of the telencephalon. The first gradient occurred in the cortical ventricular zone and established ephrin-A5 as one of the earliest markers distinguishing cells residing in the anterior versus posterior cortical neuroepithelium. The second gradient was apparent in the subplate and occurred in spatial opposition to a distinct gradient for the low-affinity NGF receptor p75. This finding reveals that different regions of the early subplate are molecularly heterogeneous. Third, we confirmed that ephrin-A5 is expressed in a bi-directional gradient in the cortical plate, with highest levels in the somatomotor cortex. Three putative receptors for ephrin-A5 EphA3, EphA4 and EphA5 showed distinct expression patterns in the developing thalamus. The graded distributions of ephrin-A5 in the developing subplate and cortex and the expression of its receptors in the thalamus are consistent with the notion that the Eph ligands and their receptors may function in the topographic mapping of thalamic axons to specific cortical areas.
| Introduction |
|---|
|
|
|---|
During the development of the nervous system, axonal growth is regulated by molecular cues that are distributed along the pathways through which the axons grow and within their target destinations (Cook et al., 1998
It has long been appreciated that the cortex is organized along its tangential dimension into distinct areas that perform specialized functions (Brodmann, 1909
). Neurons in different areas acquire thalamic inputs that determine their functional modality: for example, neurons in the auditory cortex are normally innervated by inputs from the medial geniculate nucleus (MGN) of the thalamus (Kreig, 1946
), which conveys auditory information via the midbrain from the cochlea. If retinal axons are misrouted experimentally into the MGN, the auditory cortex in these miswired animals now responds to visual stimulation (Sur et al., 1988
). Thus the specificity of thalamocortical connections is crucial for the normal processing of sensory information. How this specificity is achieved during development remains unclear. It seems likely that thalamic axons somehow detect differences between possible target areas, but it is not known whether these differences emerge within the progenitor cells of the cortical ventricular zone (Rakic, 1988
) well before thalamic axon invasion, or within the cortex itself around the time of axon ingrowth (O'Leary, 1989
). To date, the strongest candidate for playing a role in thalamocortical axon targeting is the limbic-associated membrane protein (LAMP), which appears to help guide the axons from the limbic thalamus to the perirhinal (limbic) cortex (Barbe and Levitt, 1992
). The molecules that orchestrate the development of sensory and motor projections remain unknown, although a number of possibilities, such as the cadherins (Suzuki et al., 1997
) and ephrins (Gao et al., 1998
), have been suggested.
Recent studies have identified a large family of candidate molecules that may coordinate the development of axonal connections in both the central and peripheral nervous systems. The ephrins comprise a family of putative axon guidance ligands, and their cognate receptors are known as the Eph receptor tyrosine kinases (RTKs) (reviewed by Flanagan and Vanderhaeghen, 1998). The Eph family is the largest known subfamily of receptor tyrosine kinases, with over a dozen members identified to date. Similar to other RTKs, the Eph-type receptors possess an extracellular ligand binding domain, a hydrophobic segment than anchors the proteins in the plasma membrane, and an intracellular domain that displays catalytic activity. The identified ligands of Eph-type RTKs are all membrane-anchored. This membrane anchorage appears to be essential for efficient receptor activation and allows the ligands to be deployed with the spatial resolution that is necessary to encode positional information. The ligands for Eph-type receptors fall into two classes. Members of the ephrin-A class are anchored to the cell membrane by a GPI-link, whereas members of the ephrin-B class span the plasma membrane with their transmembrane domain. The ligands of each class appear to interact with a separate set of Eph-like receptors, but within each class there appears to be a considerable amount of promiscuity in receptorligand binding (Brambilla et al., 1995
; Gale et al., 1996
).
Members of the Eph-receptor and ephrin gene families play key roles in directing retinal axon terminals to the proper target areas in the tectum (Cheng et al., 1995
; Drescher et al., 1995
; Nakamoto et al., 1996
; Monschau et al., 1997
; Frisen et al., 1998
) and the thalamus (Feldheim et al., 1998
). Two GPI-linked ligands, ephrin-A5 and ephrin-A2, are expressed in a decreasing posterior-to-anterior gradient within the chicken tectum (Cheng et al., 1995
; Drescher et al., 1995
) and in multiple gradients within the pretectal nuclei and thalamus (Feldheim et al., 1998
). A cognate Eph-receptor, EphA3, is expressed in a temporal-to-nasal gradient in the retina (Cheng et al., 1995
). In vitro and in vivo experiments suggest a role for ephrin-A2 and ephrin-A5 in regulating the growth and branching of retinal ganglion cell axons. Both function as repulsive factors for temporal retinal axons (Drescher et al., 1995
; Nakamoto et al., 1996
; Monschau et al., 1997
; Feldheim et al., 1998
), and by virtue of their expression in the most posterior region of the tectum, probably promote the formation of temporal axon terminals in more anterior regions of tectum. Gene targeting experiments in mice have confirmed that ephrin-A5 is required for the normal development of the retinotectal map (Frisen et al., 1998
) and the topographic organization of visual inputs to the thalamus (Feldheim et al., 1998
). Members of the Eph family have been implicated in the topographic mapping of hippocampalseptal projections (Gao et al., 1996
) and the development of intracortical axonal connections (Castellani et al. , 1998
). Finally, ephrin-A5 inhibits axon growth by limbic neurons in both the thalamus and cortex, which may prevent the inappropriate innervation of primary sensorimotor areas by these neurons (Gao et al., 1998
).
We were interested in further exploring the possibility that Eph-type receptors and their ligands might function in the development of axonal connections between thalamic nuclei and their cortical target areas. A candidate cellular structure that may express axon guidance cues for innervating thalamic axons is the cortical subplate, a transient zone of neurons in the primitive white matter, and one of the first layers generated during cortical development (Luskin and Shatz, 1985
). When thalamic axons first reach the cortex (at embryonic day 1618 in the rat: Catalano et al., 1996) their target cells of layer 4 are still migrating into the cortical plate. The thalamic axons pause in the subplate and form temporary synaptic connections with subplate neurons (Shatz and Luskin, 1986
; Herrmann et al., 1994
); these transient connections are maintained until layer 4 neurons have migrated into place. Besides serving as a waiting station, subplate cells also play an important role in targeting thalamic axons to the proper cortical area. Thalamic axons growing through the intermediate zone extend branches into the overlying subplate, as if sampling different regions of subplate until they identify the appropriate target area (Ghosh and Shatz, 1992
; Catalano et al., 1996
). The ablation of a small region of subplate results in the failure of thalamic axons normally destined for that region to stop and invade the appropriate cortical area (Ghosh et al., 1990
; Ghosh and Shatz, 1993
). These observations suggest that subplate neurons express area-specific or regionally distinct markers that are recognized by thalamic axons and required for target selection.
To address the question of whether Eph-type receptors and their ligands may be involved in the guidance of thalamic axons or the formation of area-specific targeting cues, we investigated the expression of several of these molecules in the forebrain. We report here on the in-situ hybridization expression patterns of ephrin-A5 and three Eph-like receptors.
| Materials and Methods |
|---|
|
|
|---|
Animals
We used timed-pregnant Long-Evans rats (Simonsen). The day of vaginal plug detection was considered embryonic day 0 (E0). Several embryonic and postnatal rats were analysed at each of the following ages: E11 (n = 8 animals; three litters), E13 (n = 9; three litters), E15 (n = 8; three litters), E17 (n = 16; five litters), E19 (n = 12; four litters), E21 (n = 4; two litters), P0 (n = 2; two litters), P1 (n = 2; two litters), and P6 (n = 2; two litters).
Preparation of Brain Sections
Postnatal rats or pregnant mothers were anesthetized with an overdose of Nembutal (100 mg/kg body weight, i.p.). Brains were dissected from pups or fetuses, placed in OCT embedding compound, and immediately frozen on dry ice. The brains were stored at 80°C until use. 15 µm sections were collected onto polylysine-coated slides. The sections were postfixed in 4% paraformaldehyde (pH 7.0), washed in PBS, dehydrated in ethanol, and finally stored at 80°C.
Preparation of Riboprobes
Probe templates were either generated by linearization of plasmids containing a segment of the gene or by PCR amplification using primers that contained the T3 or the T7 RNA polymerase promoter sequences (see details below). All templates were gel-purified before being included in the in-vitro transcription reaction.
The sense and antisense probes of human ephrin-A5 were transcribed from a construct that contained approximately 0.7 kb of the open reading frame as a XhoI/NotI fragment cloned into pBluescript. The plasmid was linearized with either XhoI (antisense) or NotI (sense) and transcribed in the presence of [35S]UTP with either T3 polymerase (antisense) or T7 (sense) polymerase to generate the riboprobes.
The template for the 3'-terminal probe of ephrin-A5 was generated by PCR amplification of a 294 bp fragment (bp 724977 of the ephrin-A5 gene) using the primers 5'-nnnnnnn gtaatacgactcactatagggc TGCAAT0 CCCAGATAATGGAA-3' and 5'-nnnnnnn aattaaccctcactaaaggg TGTGACAAGTGATGGGAGGA-3'. The antisense probe was generated from this template using T3 RNA polymerase.
The antisense probe of human ephrin-A3 was transcribed from a construct that contained ~1.0 kb of the open reading frame as a BglII fragment cloned into the BamHI site of pBluescript. The plasmid was linearized with Xho I and transcribed in the presence of S35-UTP with T3 polymerase to generate antisense riboprobes.
The antisense probe of mouse ephrin-A4 was transcribed from a construct that contained ~0.7 kb of the open reading frame as a BglII fragment cloned into the BamHI site of pBluescript. The plasmid was linearized with XhoI and transcribed in the presence of S35-UTP with T3 polymerase to generate the antisense riboprobes.
The template for the murine p75 probe was generated by PCR amplification of a 647 bp fragment (bp 188794; the template for amplification was obtained from L. Reichard's laboratory and contained the p75 ORF plus 60 bp of the upstream and 300 bp of the downstream sequences cloned into a pGEMHE vector) using the primers 5'-AGCGCGC aattaaccctcactaaaggg TGCTGATTCTAGGGGTGTCC-3' and 5'-AGCGCGC gtaatacgactcactatagggc TCACCATATCCGCCACTGTA-3'. The antisense probe was generated from this template using T7 RNA polymerase. The sense probe was generated using T3 RNA polymerase.
The template for the EphA3 probe was generated by PCR amplification of a 541 bp fragment (bp 52555 of the EphA3 gene) using the primers 5'-nnnnnnn aattaaccctcactaaaggg AAGAGCTCAGCTCTGACACCCC-3' and 5'-nnnnnnn atacgactcactatag TGCCAAGCTTGTCGACCAGG-3'. The antisense probe was generated from this template using T3 RNA polymerase. The sense probe was generated using T7 RNA polymerase.
The template for the EphA4 probe was generated by PCR amplification of a 533 bp fragment (bp 215709 of the EphA4 gene) using the primers 5'-nnnnnnn aattaaccctcactaaaggg GAGGAAGTGAGCATTATGGA-3' and 5'-nnnnnnn gtaatacgactcactatagggc GCCTCGAACTTCCACCAG-3'. The antisense probe was generated from this template using T3 RNA polymerase. The sense probe was generated using T7 RNA polymerase.
The template for the EphA5 probe was generated by PCR amplification of a 524 bp fragment (bp 130617 of the EphA5 gene) using the primers 5'-nnnnnnn aattaaccctcactaaaggg GCTATTCCGCACCTCTAA-3' and 5'-nnnnnnn gtaatacgactcactatagggc GAGGTCCTACATCTCTGA-3'. The antisense probe was generated from this template using T7 RNA polymerase. The sense probe was generated using T3 RNA polymerase.
In Situ Hybridization
The protocol for in situ hybridization was modified from that of Simmons et al. (Simmons et al., 1989
), as described more fully in Frantz et al. (Frantz et al., 1994
). Sections were pretreated with proteinase K (0.9 µg/ml) and acetic anhydride, and dehydrated in a series of ethanol baths. Hybridization occurred overnight at 65°C. Following hybridization, the sections were treated with ribonuclease A (50 µm/ml) at 37°C for 30 min before being washed at high stringency in 0.1 x SSC at 60°C.
Autoradiography and Photography
Sections were once again dehydrated in a series of alcohols and xylenes and air-dried before being dipped into Kodak NTB2 nuclear track emulsion and stored for 47 weeks in the dark at 4°C. Finally, the sections were developed with Kodak D-19, fixed with Kodak Rapid Fix, and counterstained with cresyl violet. Images of selected sections were captured through a CCD camera and processed using Adobe Photoshop. None of the sense control probes generated signal above background levels (data not shown).
| Results |
|---|
|
|
|---|
Ephrin-A5 Expression in the Telencephalic Ventricular Zone
The expression pattern of ephrin-A5 in the developing rat forebrain was analysed by in-situ hybridization. Sagittal and coronal sections of rat brains from embryonic day 11 (E11) to postnatal day 1 (P1) were hybridized with an ephrin-A5 antisense riboprobe. This developmental period encompasses the onset of neurogenesis, neuronal migration, and the growth of axonal and dendritic processes in the forebrain (McConnell, 1995
). The first positive hybridization signal was detected at E11 (Fig. 1A
). As previously reported by others, ephrin-A5 expression was graded in the dorsal mesencephalon, being more highly expressed in the neuroepithelium of the inferior colliculus and decreasing sharply towards the anterior superior colliculus (data not shown) (Cheng and Flanagan, 1994
). Ephrin-A5 mRNA expression was also graded in the telencephalon at E11: mRNA was most abundant in the anterior telencephalon, and expression decreased from this anterior tip towards posterior regions, both in the ventral half of the telencephalon (the neuroepithelium of the developing basal ganglia) and in the dorsal half of the telencephalon (the developing neocortex) (Fig. 1A
). This anterior to posterior expression gradient in the forebrain is in the orientation opposite to that observed in the midbrain.
|
The gradient of ephrin-A5 expression in the telencephalic ventricular zone was also apparent at E13 (Fig. 1B, 2A
|
The graded expression of ephrin-A5 in the dorsal and ventral telencephalic ventricular zones persisted until E19, an age at which cortical neurogenesis is coming to a close (Frantz et al., 1994
Collectively, these results suggest that ephrin-A5 forms a true spatial gradient rather than a maturational or temporal gradient. It has long been appreciated that anterior and temporal regions of cortex are developmentally more advanced than are posterior and medial areas; however, at their most extreme these differences reflect no more than 2 days in maturational stage (Uylings et al., 1990
). Our evidence from ages ranging from E11 to at least E17 indicates that ephrin-A5 is always expressed at higher levels in the anterior ventricular zone than in posterior regions, and thus forms a temporally stable spatial gradient of gene expression.
Ephrin-A5 and p75 mRNAs Form Opposing Gradients in the Subplate
Because the subplate is likely to play an important role in the topographic mapping of thalamic axons to the cerebral cortex, we were particularly interested in the expression pattern of ephrin-A5 in this cellular structure. Upon reaching the cortex, thalamic axons form their first synapses in the subplate (Shatz and Luskin, 1986
; Herrmann et al., 1994
), and the axons appear to be incapable of identifying their proper cortical target area in the absence of the subplate (Ghosh et al., 1990
; Ghosh and Shatz, 1993
). It is thus likely that the subplate encodes guidance cues that are used by ingrowing thalamic axons to map to the correct area of the cortex.
In-situ hybridization revealed that ephrin-A5 was indeed expressed in the embryonic subplate, and moreover that it was expressed in a graded pattern, similar to that observed at earlier ages in the dorsal mesencephalon and cortical ventricular zone. At E17, ephrin-A5 expression in the newly formed subplate was only visible in the most anterior cortical regions and was absent from middle and posterior areas (Fig. 1D
). Analysis of coronal sections revealed that ephrin-A5 mRNA was also expressed in a lateral to medial gradient in the subplate (Fig. 1E
). The graded distribution of ephrin-A5 message in the subplate was even more apparent at E19 (Figs 1F, 3A![]()
) and during early postnatal life (Figs 1G, 3C![]()
).
|
To identify cortical subplate cells more accurately, we used the low-affinity NGF receptor p75 as a marker. p75 has previously been reported to be expressed in embryonic subplate cells (Allendoerfer et al., 1990
|
Ephrin-A5 Expression in the Cortical Plate
A third gradient of ephrin-A5 expression in the developing neocortex became apparent with the emergence of the cortical plate and was quite evident by E19 (Fig. 1F
). Ephrin-A5 message in the cortical plate was most abundant in the mid-dorsal area of sagittal sections. Its abundance tapered off gradually towards anterior regions and more sharply towards posterior regions. This graded expression was even more pronounced at later ages (see P1 in Fig. 1G
). Three-dimensional reconstructions of sagittal and coronal sections of P1 rat brains (not shown) revealed that the highest levels of ephrin-A5 hybridization in the cortical plate were present in a central region in each cortical hemisphere, corresponding to presumptive somatosensory cortex. At P1, ephrin-A5 mRNA was distributed across all cortical layers that are present in the cortical plate at this age, with the exception of the marginal zone (layer 1) (Fig. 1G
). Particularly high levels of expression were apparent in layer 5 at P1, and in layers 4 and 5 at P6 (not shown; this contrasts somewhat with the results Castellani et al. (Castellani et al., 1998
), who saw expression limited to layer 4). In more anterior regions at P1, ephrin-A5 expression was markedly diminished in all layers and almost absent in layer 6 (Fig. 1G
). Expression in the posterior cortical plate was also reduced, but much less severely. The pattern of ephrin-A5 expression in the somatosensory cortex is similar to that reported recently (Gao et al., 1998
).
Expression of Ephrin-A3 and Ephrin-A4 in the Forebrain
Because we utilized a full-length human ephrin-A5 probe for these studies, we needed to verify that the hybridization signal observed was indeed due to the presence of ephrin-A5 mRNA rather than due to cross-hybridization with related molecules. In-situ hybridization experiments were performed on neighboring brain sections from E19 rats using probes directed against the coding regions of two other members of the ephrin-A class of ligands, human ephrin-A3 and mouse ephrin-A4. We also used a probe directed against the 3'-end of human ephrin-A5, the region that shows the least amount of homology to other ephrins. As shown in Figure 5A
, only very low levels of ephrin-A4 message were present in the developing rat forebrain. Ephrin-A3, on the other hand, was expressed widely and at high levels in the cortical plate and subplate (Fig. 5B
), but in a pattern distinct from that seen for ephrin-A5. Most notable, ephrin-A3 is expressed uniformly throughout the subplate. Thus hybridization with neither the ephrin-A3 nor the ephrin-A4 antisense probe resulted in the specific and graded hybridization pattern obtained with the ephrin-A5 probe (Fig. 5D
). Only hybridization with the 3'-end probe of ephrin-A5 (Fig. 5C
) reproduced the graded expression profiles in the ventricular zone, subplate, and cortical plate that were seen using the full length probe (Fig. 5 D
). These results indicate that the full-length ephrin-A5 probe used for these studies did not cross-hybridize with related ephrins, and that the observed graded expression pattern in the forebrain was specific to ephrin-A5.
|
Distribution of Putative Receptors for Ephrin-A Ligands
To interpret the positional information encoded in the graded distribution of ephrin-A5, responding cells or axons must express a cognate receptor. We therefore analysed the expression profile of several ephrin-A5 receptors in the forebrain. There is a considerable degree of promiscuity in the interaction between Eph-like receptors and their ligands. In vitro, ephrin-A5 interacts with any of the eight known members of the EphA receptor family (Gale et al., 1996
). We analysed the expression pattern of three of these receptors, EphA3, EphA4, and EphA5. To enable the accurate localization of receptor mRNA in various nuclei of the developing thalamus, hybridization profiles were obtained from coronal sections at E17 (an age at which thalamic neurons are extending axons to the cortex in the rat: Catalano et al., 1996), E19, and P1.
At E17 all three receptors were expressed in the developing brain (Fig. 6A, D, G
). EphA3 mRNA was expressed at high levels in both the telencephalon and dorsal thalamus (Fig. 6A
). In the developing neocortex, EphA3 was expressed in the ventricular zone and cortical plate, and at much higher levels in the subventricular zone and the subplate. EphA3 was also expressed in the ventricular zone of the ventral telencephalon and at lower levels in the subventricular zone and the differentiating field of the basal ganglia and amygdala. In the diencephalon, expression of EphA3 was concentrated in the dorsal thalamus. Specific thalamic nuclei in which EphA3 was expressed at high levels included the ventral posterior (VP) and laterodorsal (LD) nuclei, as well as more medial dorsal nuclei (Fig. 6A
); expression was notably absent from the ventral lateral geniculate nucleus (vLGN), but was strong in the dorsal lateral geniculate nucleus (dLGN; not shown). At E19, high expression was still observed in VP and LD, as well as dLGN (Fig. 6B
). At early postnatal ages the same subset of thalamic nuclei continued to express EphA3, although expression levels in the thalamus appeared lower compared to earlier ages (Fig. 6C
). Within the neocortex at later ages, the EphA3 probe labeled the cortical plate, subplate, and subventricular zone. Expression in the subplate was quite distinctive; notably, no gradient of expression was observed in either the mediolateral plane (Fig. 6C
) or anteroposterior plane (not shown).
|
EphA4 was expressed at high levels within the E17 telencephalon throughout the ventricular zone, the subventricular zone, and the cortical plate of the neocortex (Fig. 6D
The expression of EphA5 differed markedly from that seen for EphA3 or EphA4. High levels of EphA5 staining were observed throughout the embryonic telencephalon, particularly in the hippocampus, the neocortical ventricular and subventricular zone of the developing neocortex and in the basal ganglia, and extended past the rhinencephalon into the amygdala (Fig. 6G, H
). EphA5 expression was far lower in the cortical plate than in the proliferative zones. In the diencephalon of embryonic brains, EphA5 mRNA was highly expressed in the habenular nucleus, dorsal thalamus, and hypothalamus (Fig. 6G, H
), with the strongest expression in the medial thalamus and epithalamus. The levels of expression in dLGN and VP were markedly lower, at roughly background levels, compared to structures such as vLGN and the medial thalamic nuclei, in which expression levels were high (Fig. 6GI
). At postnatal ages, EphA5 continued to be expressed at high levels throughout the hippocampus and the cortex (Fig. 6I
). As observed for EphA3, the subplate was distinctly labeled by the EphA5 probe. Expression was also present in a number of thalamic nuclei, with expression notably absent from dLGN and VP, but present in vLGN.
| Discussion |
|---|
|
|
|---|
Axonal connections in the cerebral cortex are organized in specific patterns in both the radial dimension (between the neurons of different layers) and the tangential dimension (between neurons in different cortical areas and between cortical neurons and subcortical targets) (Gilbert, 1983
Ephrin-A5 in the Cortical Plate
One of the three gradients of ephrin-A5 expression emerged in the cortical plate at around E19. Three-dimensional reconstructions of sagittal and coronal sections revealed that the highest level of ephrin-A5 message was present in the somatosensory area of the cortex. Within this region, expression of ephrin-A5 was highest in layer 5 and by P6 was also quite high in layer 4. These results differ somewhat from those of Castellani et al. (1998), who showed that ephrin-A5 is expressed only in layer 4 of the cortical plate at P7, an age at which ephrin-A5 and EphA5 appear to play a role in the establishment of interlaminar connections within the cortex. At earlier times in development, ingrowing thalamic axons must traverse layers 6 and 5 of the cortex to reach their target neurons in layer 4. It is of interest in this context that there was a distinctive lack of expression of one of the putative receptors of ephrin-A5, EphA5, in the ventral posterior nucleus (VP) of the thalamus, because neurons from this thalamic structure innervate the somatosensory cortex in which ephrin-A5 levels are highest. Our findings differ somewhat from the results of Gao et al. (Gao et al., 1998
). Both our study and that of Gao et al. observed high levels of ephrin-A5 message in somatosensory cortex. However, while they reported little or no EphA5 expression outside the medial thalamic nuclei, our experiments revealed that EphA5 is also expressed, albeit differentially and at overall lower levels, in the lateral and ventral (sensorimotor) nuclei of the thalamus. Since ephrin-A5 has been shown to repulse axons that can detect the presence of this ligand (Drescher et al., 1995
; Gale et al., 1996
), the lack of EphA5 expression in VP cells may enable their axons to invade the cortical plate in the area of high ephrin-A5 expression, as suggested previously (Gao et al., 1998
). This hypothesis remains to be tested by analysing thalamocortical projections in ephrin-A5 or EphA5 mutant mice.
Ephrin-A5 in the Ventricular Zone
At earlier times in development we also observed a gradient of ephrin-A5 message in telencephalic progenitor cells. The expression gradient was already apparent within the ventricular zone at E11, and it persisted until E19, a time when neurogenesis ceases and the neuroepithelium disappears (Frantz et al., 1994
). Ephrin-A5 was most abundant in the anterior tip of the telencephalon (the developing olfactory bulb) with levels sharply decreasing toward more posterior regions of the cortical and the septal neuroepithelium. Beginning at E16, ephrin-A5 expression shifted from the ventricular zone to progenitors of the subventricular zone.
This observation suggests that there is spatial information present within the ventricular zone at a time when cortical neurons are being generated. The question of how regional differences arise in distinct cortical areas has long fascinated those who study cortical development (Rakic, 1988
; O'Leary, 1989
). Several investigators have suggested that at least some aspects of areal fate determination may be specified in the ventricular zone. Well before thalamic axons innervate the cortex, the paired-box gene Pax-6 and the homeobox gene Emx2 are expressed in gradients along the anteriorposterior axis of the cortical neuroepithelium (Walther and Gruss, 1991
; Simeone et al., 1992
). Ephrin-A5 constitutes another example of a gene that displays a graded expression pattern in the cortical neuroepithelium, further supporting the notion that some level of intrinsic specification may exist in the cortical primordium, independent of the extrinsic influences of thalamic input.
It is not clear how or whether ephrin-A5 might function at such early stages of cortical development. Indeed, all three of the putative receptors for ephrin-A5 we studied, EphA3, EphA4, and EphA5, were expressed widely in the developing cortex, including the ventricular and subventricular zones, implying that individual progenitor cells might co-express both ligand and receptor. It is conceivable that interactions between Eph receptors and ephrin-A5 could mediate or regulate a variety of developmental processes in the early cortex, including the differentiation and migration patterns of cortical neurons, as has been observed for migrating neural crest cells (Wang and Anderson, 1997
).
Ephrin-A5 in the Subplate
In contrast to the cortical ventricular zone, to date there have been no reports of positional differences among subplate neurons, despite the hypothesis that such differences might play a key role in the targeting of thalamic axons to appropriate cortical areas (Ghosh and Shatz, 1993
). The graded expression of ephrin-A5 and the low-affinity NGF receptor p75 reported here provide a first indication that this cell layer is not regionally homogeneous. From E17 onwards, anterior and posterior subplate cells differ in their expression of ephrin-A5 and p75: anterior subplate cells express high levels of ephrin-A5, whereas posterior subplate cells express p75 mRNA. The stability of these gradients over time, and the uniform expression of ephrin-A3 in the subplate at the same time (Fig. 5b
), suggest that ephrin-A5 is expressed in a true spatial gradient and is not simply reflecting maturational differences between subplate neurons (Uylings et al., 1990
). Our observations raise the possibility that thalamic axons might identify their target area by using the graded expression in the subplate of an axon pathfinding cue such as ephrin-A5. A simple prediction is that for such a mechanism to function successfully, thalamic neurons innervating more frontal areas of cortex, which express high ligand levels, should show low levels of receptor expression. Conversely, visual thalamic neurons innervating the low-ligand-expressing occipital cortex could afford to express high levels of Eph receptors. However, the expression patterns of three putative receptors for ephrin-A5, EphA3, EphA4, and EphA5, are more complicated than predicted by such a simple notion. All three receptors are indeed expressed in the thalamus. Two of the receptors, EphA3 and EphA4, are expressed at high levels in most nuclei of the dorsal thalamus, including visual nuclei (dLGN and vLGN), somatosensory nuclei (VP), and the medial thalamic nuclei (which project to frontal regions). EphA5 expression showed a more complex pattern in the dorsal thalamus, being most robust in medial nuclei with generally lower expression in the more laterally situated nuclei. However, relatively high levels of expression were detected in vLGN and LD compared to dLGN and VP, in which expression was negligible. It is not clear whether these complex spatial patterns of Eph receptor expression could confer areal specificity onto ingrowing thalamic axons.
If most or all neurons in the dorsal thalamus express some combination of Eph receptors, how might thalamic axons be differentially sensitive to the graded expression of ephrin-A5 in the cortical subplate? One possibility is that the timing of axon arrival may correlate with different levels of ephrin expression in the subplate. Axons from the thalamus first reach the cortex at E16 in the rat (Catalano et al., 1996
), an age just before the onset of ephrin-A5 expression in the subplate. It is thus unlikely that ephrin-A5 guides the initial innervation of more anterior and lateral regions of the cortex. It is possible, however, that ephrin-A5 expression at slightly later times could repel later-arriving thalamic axons from the already innervated areas and steer them to progressively more posterior and medial regions of the cortex. At E17, the earliest age at which we detect ephrin-A5 expression in the subplate, thalamic axons are just innervating the subplate area below the future somatosensory area (Catalano et al., 1996
), which at this age is devoid of ephrin-A5 message. Later-arriving axons from the visual thalamus may encounter increased levels of ephrin-A5 in temporal and frontal regions of cortex, which might then repel the axons into more posterior (visual) cortical regions. This notion is consistent with the observation that thalamic innervation of the cortex occurs in an anterior to posterior and lateral to medial gradient, the same gradient in which ephrin-A5 message is distributed. However, given the overlap in both neurogenesis and axon ingrowth from different thalamic nuclei, this model cannot fully explain the precision with which thalamic axons identify and innervate their cortical targets.
In summary, we have shown that ephrin-A5 message is distributed in distinct gradients during the development of the telencephalon. Our studies identified ephrin-A5 as one of the earliest markers of anterior-to-posterior specification of cells in the cortical neuroepithelium. In addition, the graded expression of ephrin-A5 in the cortical plate, combined with the lack of expression of the putative ephrin-A5 receptor EphA5 in VP of the thalamus, supports the suggestion by Gao et al. (Gao et al., 1998
) that this ligand/receptor pair may function in the innervation by thalamic axons of somatosensory cortex. Lastly, we have shown that ephrin-A5 and the low-affinity NGF receptor p75 are expressed in the subplate in opposing gradients, revealing that the early subplate is not a molecularly homogeneous structure. Most neurons in the dorsal thalamus express the Eph receptors EphA3 and EphA4, and the graded expression of ephrin-A5 in the subplate mirrors the spatiotemporal gradient of cortical innervation by thalamic axons. These observations thus raise the possibility that ephrin-A5 may participate in the topographic mapping of thalamic axons to specific cortical areas, a hypothesis that remains to be tested directly.
| Notes |
|---|
We wish to thank Lou Reichardt for providing the p75 template and Margaret Levin for help with in-situ experiments. Special thanks to Susan Catalano for critical review of the paper and help with the identification of thalamic structures. This study was supported by NIH NS12151 and EY08411 (to S.K.M.) and a postdoctoral fellowship from the American Cancer Society, California Division (to K.M.). K.Mackaraehtschian is now at: Incyte Pharmaceuticals, Palo Alto, California, USA. I. Caras is now at: EOS Biotechnology, South San Francisco, California, USA.
Please address correspondence to: Dr Susan K. McConnell, Department of Biological Sciences, Stanford University, 385 Serra Mall, Stanford, CA 943055020, USA.E-mail: suemcc{at}stanford.edu.
| References |
|---|
|
|
|---|
Allendoerfer KL, Shelton DL, Shooter EM, Shatz CJ (1990) Nerve growth factor receptor immunoreactivity is transiently associated with the subplate neurons of the mammalian cerebral cortex. Proc Natl Acad Sci USA 87:187190.
Barbe MF, Levitt P (1992) Attraction of specific thalamic input by cerebral grafts depends on the molecular identity of the implant. Proc Natl Acad Sci USA 89:37063710.
Brambilla R, Schnapp A, Casagranda F, Labrador JP, Bergemann AD, Flanagan JG, Pasquale EB, Klein R (1995) Membrane-bound LERK2 ligand can signal through three different Eph-related receptor tyrosine kinases. EMBO J 14:31163126.[Web of Science][Medline]
Brodmann K (1909) Vergleichende Lokalisationslehre der Grosshirnrinde in ihren Prinzipien dargestellt auf Grund des Zellenbaues. Leipzig: Barth.
Castellani V, Yue Y, Gao PP, Zhou R, Bolz J (1998) Dual action of a ligand for Eph receptor tyrosine kinases on specific populations of axons during the development of cortical circuits. J Neurosci 18:46634672.
Catalano SM, Robertson RT, Killackey HP (1996) Individual axon morphology and thalamocortical topography in developing rat somatosensory cortex. J Comp Neurol 367:3653.[Web of Science][Medline]
Cheng HJ, Flanagan JG (1994) Identification and cloning of ELF-1, a developmentally expressed ligand for the Mek4 and Sek receptor tyrosine kinases. Cell 79:157168.[Web of Science][Medline]
Cheng HJ, Nakamoto M, Bergemann AD, Flanagan JG (1995) Complementary gradients in expression and binding of ELF-1 and Mek4 in development of the topographic retinotectal projection map. Cell 82:371381.[Web of Science][Medline]
Cook G, Tannahill D, Keynes R (1998) Axon guidance to and from choice points. Curr Opin Neurobiol 8:6472.[Web of Science][Medline]
Drescher U, Kremoser C, Handwerker C, Loschinger J, Noda M, Bonhoeffer F (1995) In vitro guidance of retinal ganglion cell axons by RAGS, a 25 kDa tectal protein related to ligands for Eph receptor tyrosine kinases. Cell 82:359370.[Web of Science][Medline]
Feldheim DA, Vanderhaeghen P, Hansen MJ, Frisén J, Lu Q, Barbacid M, Flanagan JG (1998) Topographic guidance labels in a sensory projection to the forebrain. Neuron 21:13031313.[Web of Science][Medline]
Flanagan JG, Vanderhaeghen P (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci 21:309345.[Web of Science][Medline]
Frantz GD, Bohner AP, Akers RM, McConnell SK (1994) Regulation of the POU-domain gene SCIP during cerebral cortical development. J Neurosci 14:472485.[Abstract]
Frisen J, Yates PA, McLaughlin T, Friedman GC, O'Leary DD, Barbacid M (1998) Ephrin-A5 (AL-1/RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system. Neuron 20:235243.[Web of Science][Medline]
Gale NW, Holland SJ, Valenzuela DM, Flenniken A, Pan L, Ryan TE, Henkemeyer M, Strebhardt K, Hirai H, Wilkinson DG, Pawson T, Davis S, Yancopoulos GD (1996) Eph receptors and ligands comprise two major specificity subclasses and are reciprocally compartmentalized during embryogenesis. Neuron 17:919.[Web of Science][Medline]
Gao PP, Zhang JH, Yokoyama M, Racey B, Dreyfus CF, Black IB, Zhou R (1996) Regulation of topographic projection in the brain: Elf-1 in the hippocamposeptal system. Proc Natl Acad Sci USA 93:1116111166.
Gao PP, Yue Y, Zhang JH, Cerretti DP, Levitt P, Zhou R (1998) Regulation of thalamic neurite outgrowth by the Eph ligand ephrin-A5: implications in the development of thalamocortical projections. Proc Natl Acad Sci USA 95:53295334.
Ghosh A, Shatz CJ (1992) Pathfinding and target selection by developing geniculocortical axons. J Neurosci 12:3955.[Abstract]
Ghosh A, Shatz CJ (1993) A role for subplate neurons in the patterning of connections from thalamus to neocortex. Development 117: 10311047.[Abstract]
Ghosh A, Antonini A, McConnell SK, Shatz CJ (1990) Requirement for subplate neurons in the formation of thalamocortical connections. Nature 347:179181.[Medline]
Gilbert CD (1983) Microcircuitry of the visual cortex. Annu Rev Neurosci 6:217247.[Web of Science][Medline]
Gilbert CD, Wiesel TN (1985) Intrinsic connectivity and receptive field properties in visual cortex. Vision Res 25:365374.[Web of Science][Medline]
Herrmann K, Antonini A, Shatz CJ (1994) Ultrastructural evidence for synaptic interactions between thalamocortical axons and subplate neurons. Eur J Neurosci 6:17291742.[Web of Science][Medline]
Koh S, Higgins GA (1991) Differential regulation of the low-affinity nerve growth factor receptor during postnatal development of the rat brain. J Comp Neurol 313:494508.[Web of Science][Medline]
Kreig W (1946) Connections of the cerebral cortex. I. The albino rat. A. Topography of the cortical areas. J Comp Neurol 84:221275.[Web of Science]
Luskin MB, Shatz CJ (1985) Studies of the earliest generated cells of the cat's visual cortex: cogeneration of subplate and marginal zones. J Neurosci 5:10621075.[Abstract]
McConnell, S.K. (1995) Constructing the cerebral cortex: neurogenesis and fate determination. Neuron 15:761768.[Web of Science][Medline]
Monschau B, Kremoser C, Ohta K, Tanaka H, Kaneko T, Yamada T, Handwerker C, Hornberger MR, Loschinger J, Pasquale EB, Siever DA, Verderame MF, Muller BK, Bonhoeffer F, Drescher U (1997) Shared and distinct functions of RAGS and ELF-1 in guiding retinal axons. EMBO J 16:12581267.[Web of Science][Medline]
Nakamoto M, Cheng HJ, Friedman GC, McLaughlin T, Hansen MJ, Yoon CH, O'Leary DD, Flanagan JG (1996) Topographically specific effects of ELF-1 on retinal axon guidance in vitro and retinal axon mapping in vivo. Cell 86:755766.[Web of Science][Medline]
O'Leary DD (1989) Do cortical areas emerge from a protocortex? Trends Neurosci 12:400406.[Web of Science][Medline]
Rakic P (1988) Specification of cerebral cortical areas. Science 241: 170176.
Serafini T, Kennedy TE, Galko MJ, Mirzayan C, Jessell TM, Tessier-Lavigne M (1994) The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell 78:409424.[Web of Science][Medline]
Serafini T, Colamarino SA, Leonardo ED, Wang H, Beddington R, Skarnes WC, Tessier-Lavigne M (1996) Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system. Cell 87: 10011014.[Web of Science][Medline]
Shatz CJ, Luskin MB (1986) The relationship between the geniculocortical afferents and their cortical target cells during development of the cat's primary visual cortex. J Neurosci 6:36553668.[Abstract]
Simmons DM, Arriza JL, Swanson LW (1989) A complete protocol for in situ hybridization of messenger RNAs in brain and other tissues with radiolabeled single-stranded RNA probes. J Histotech 12:169181.
Simeone A, Gulisano M, Acampora D, Stornaiuolo A, Rambaldi M, Boncinelli E (1992) Two vertebrate homeobox genes related to the Drosophila empty spiracles gene are expressed in the embryonic cerebral cortex. EMBO J 11:25412550.[Web of Science][Medline]
Sur M, Garraghty PE, Roe AW (1988) Experimentally induced visual projections into auditory thalamus and cortex. Science 242:14371441.
Suzuki SC, Inoue T, Kimura Y, Tanaka T, Takeichi M (1997) Neuronal circuits are subdivided by differential expression of type-II classic cadherins in postnatal mouse brains. Mol Cell Neurosci 9:433447.[Web of Science][Medline]
Uylings HBM, Van Eden CG, Parnavelas JG, Kalsbeek A (1990) The prenatal and postnatal development of rat cerebral cortex. In: The cerebral cortex of the rat (Kolb E, Tees RC, eds), pp. 3576. Cambridge: MIT Press.
Walther C, Gruss P (1991) Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 113:14351449.[Abstract]
Wang HU, Anderson DJ (1997) Eph family transmembrane ligands can mediate repulsive guidance of trunk neural crest migration and motor axon outgrowth. Neuron 18:383396.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H. A. North, X. Zhao, S. M. Kolk, M. A. Clifford, D. M. Ziskind, and M. J. Donoghue Promotion of proliferation in the developing cerebral cortex by EphA4 forward signaling Development, July 15, 2009; 136(14): 2467 - 2476. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, Q. Guo, and J. Y. H. Li Transcription factor Gbx2 acts cell-nonautonomously to regulate the formation of lineage-restriction boundaries of the thalamus Development, April 15, 2009; 136(8): 1317 - 1326. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Giocomo and M. E. Hasselmo Time Constants of h Current in Layer II Stellate Cells Differ along the Dorsal to Ventral Axis of Medial Entorhinal Cortex J. Neurosci., September 17, 2008; 28(38): 9414 - 9425. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Kudo, S. L. Karsten, J. Chen, P. Levitt, and D. H. Geschwind Genetic Analysis of Anterior Posterior Expression Gradients in the Developing Mammalian Forebrain Cereb Cortex, September 1, 2007; 17(9): 2108 - 2122. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nomura, J. Holmberg, J. Frisen, and N. Osumi Pax6-dependent boundary defines alignment of migrating olfactory cortex neurons via the repulsive activity of ephrin A5 Development, April 1, 2006; 133(7): 1335 - 1345. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Sansom, J. M. Hebert, U. Thammongkol, J. Smith, G. Nisbet, M. A. Surani, S. K. McConnell, and F. J. Livesey Genomic characterisation of a Fgf-regulated gradient-based neocortical protomap Development, September 1, 2005; 132(17): 3947 - 3961. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shimogori and E. A. Grove Fibroblast Growth Factor 8 Regulates Neocortical Guidance of Area-Specific Thalamic Innervation J. Neurosci., July 13, 2005; 25(28): 6550 - 6560. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhong, M. Takemoto, T. Fukuda, Y. Hattori, F. Murakami, D. Nakajima, M. Nakayama, and N. Yamamoto Identification of the Genes that are Expressed in the Upper Layers of the Neocortex Cereb Cortex, October 1, 2004; 14(10): 1144 - 1152. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Funatsu, T. Inoue, and S. Nakamura Gene Expression Analysis of the Late Embryonic Mouse Cerebral Cortex Using DNA Microarray: Identification of Several Region- and Layer-specific Genes Cereb Cortex, September 1, 2004; 14(9): 1031 - 1044. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Louvi, S. S. Sisodia, and E. A. Grove Presenilin 1 in migration and morphogenesis in the central nervous system Development, July 1, 2004; 131(13): 3093 - 3105. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hu, X. Yue, G. Shi, Y. Yue, D. P. Crockett, J. Blair-Flynn, K. Reuhl, L. Tessarollo, and R. Zhou Corpus Callosum Deficiency in Transgenic Mice Expressing a Truncated Ephrin-A Receptor J. Neurosci., November 26, 2003; 23(34): 10963 - 10970. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leingartner, L. J. Richards, R. H. Dyck, C. Akazawa, and D. D.M. O'Leary Cloning and Cortical Expression of Rat Emx2 and Adenovirus-mediated Overexpression to Assess its Regulation of Area-specific Targeting of Thalamocortical Axons Cereb Cortex, June 1, 2003; 13(6): 648 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garel, K. J. Huffman, and J. L. R. Rubenstein Molecular regionalization of the neocortex is disrupted in Fgf8 hypomorphic mutants Development, May 1, 2003; 130(9): 1903 - 1914. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hebert, M. Lin, J. Partanen, J. Rossant, and S. K. McConnell FGF signaling through FGFR1 is required for olfactory bulb morphogenesis Development, March 15, 2003; 130(6): 1101 - 1111. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garel, K. Yun, R. Grosschedl, and J. L. R. Rubenstein The early topography of thalamocortical projections is shifted in Ebf1 and Dlx1/2 mutant mice Development, March 14, 2003; 129(24): 5621 - 5634. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Mann, C. Peuckert, F. Dehner, R. Zhou, and J. Bolz Ephrins regulate the formation of terminal axonal arbors during the development of thalamocortical projections Development, March 10, 2003; 129(16): 3945 - 3955. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shinozaki, T. Miyagi, M. Yoshida, T. Miyata, M. Ogawa, S. Aizawa, and Y. Suda Absence of Cajal-Retzius cells and subplate neurons associated with defects of tangential cell migration from ganglionic eminence in Emx1/2 double mutant cerebral cortex Development, March 9, 2003; 129(14): 3479 - 3492. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Uziel, S. Muhlfriedel, K. Zarbalis, W. Wurst, P. Levitt, and J. Bolz Miswiring of Limbic Thalamocortical Projections in the Absence of Ephrin-A5 J. Neurosci., November 1, 2002; 22(21): 9352 - 9357. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Bishop, J. L. R. Rubenstein, and D. D. M. O'Leary Distinct Actions of Emx1, Emx2, and Pax6 in Regulating the Specification of Areas in the Developing Neocortex J. Neurosci., September 1, 2002; 22(17): 7627 - 7638. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. McQuillen, M. F. DeFreitas, G. Zada, and C. J. Shatz A Novel Role for p75NTR in Subplate Growth Cone Complexity and Visual Thalamocortical Innervation J. Neurosci., May 1, 2002; 22(9): 3580 - 3593. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Voigt, T. Opitz, and A. D. de Lima Synchronous Oscillatory Activity in Immature Cortical Network Is Driven by GABAergic Preplate Neurons J. Neurosci., November 15, 2001; 21(22): 8895 - 8905. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Lyckman, S. Jhaveri, D. A. Feldheim, P. Vanderhaeghen, J. G. Flanagan, and M. Sur Enhanced Plasticity of Retinothalamic Projections in an Ephrin-A2/A5 Double Mutant J. Neurosci., October 1, 2001; 21(19): 7684 - 7690. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakagawa and D. D. M. O'Leary Combinatorial Expression Patterns of LIM-Homeodomain and Other Regulatory Genes Parcellate Developing Thalamus J. Neurosci., April 15, 2001; 21(8): 2711 - 2725. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bagnard, N. Chounlamountri, A. W. Puschel, and J. Bolz Axonal Surface Molecules Act in Combination with Semaphorin 3A during the Establishment of Corticothalamic Projections Cereb Cortex, March 1, 2001; 11(3): 278 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yamamoto, K. Inui, Y. Matsuyama, A. Harada, K. Hanamura, F. Murakami, E. S. Ruthazer, U. Rutishauser, and T. Seki Inhibitory Mechanism by Polysialic Acid for Lamina-Specific Branch Formation of Thalamocortical Axons J. Neurosci., December 15, 2000; 20(24): 9145 - 9151. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Liu, N. D. Dwyer, and D. D. M. O'Leary Differential Expression of COUP-TFI, CHL1, and Two Novel Genes in Developing Neocortex Identified by Differential Display PCR J. Neurosci., October 15, 2000; 20(20): 7682 - 7690. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Prakash, P. Vanderhaeghen, S. Cohen-Cory, J. Frisen, J. G. Flanagan, and R. D. Frostig Malformation of the Functional Organization of Somatosensory Cortex in Adult Ephrin-A5 Knock-Out Mice Revealed by In Vivo Functional Imaging J. Neurosci., August 1, 2000; 20(15): 5841 - 5847. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Bishop, G. Goudreau, and D. D. O'Leary Regulation of Area Identity in the Mammalian Neocortex by Emx2 and Pax6 Science, April 14, 2000; 288(5464): 344 - 349. [Abstract] [Full Text] |
||||
![]() |
Y. Nakagawa, J. E. Johnson, and D. D. M. O'Leary Graded and Areal Expression Patterns of Regulatory Genes and Cadherins in Embryonic Neocortex Independent of Thalamocortical Input J. Neurosci., December 15, 1999; 19(24): 10877 - 10885. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Eagleson and P. Levitt Complex Signaling Responsible for Molecular Regionalization of the Cerebral Cortex Cereb Cortex, September 1, 1999; 9(6): 562 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fukuchi-Shimogori and E. A. Grove Neocortex Patterning by the Secreted Signaling Molecule FGF8 Science, November 2, 2001; 294(5544): 1071 - 1074. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











