Cerebral Cortex, Vol. 13, No. 3, 252-264,
March 2003
© 2003 Oxford University Press
Neural Development of the Neuregulin Receptor ErbB4 in the Cerebral Cortex and the Hippocampus: Preferential Expression by Interneurons Tangentially Migrating from the Ganglionic Eminences
Institute of Neuroscience, National Yang-Ming University, Taipei, Taiwan 112, Republic of China and , 1 Department of Neuropharmacology, Scripps Research Institute, La Jolla, CA 92037, USA
Address correspondence to Dr Fu-Chin Liu, Institute of Neuroscience, National Yang-Ming University, 155 Li-Rum Street, Taipei, Taiwan 112, Republic of China. Email: fuchin{at}ym.edu.tw.
| Abstract |
|---|
|
|
|---|
The receptor tyrosine kinases represent an important class of signal transduction molecules that have been shown to play critical roles in neural development. We report in the present study that the neuregulin receptor ErbB4 is preferentially expressed by interneurons that are migrating tangentially from the ventral to the dorsal rat telencephalon. ErbB4 immunoreactivity was detected in the medial ganglionic eminence as early as embryonic day (E) 13 at the inception of tangential migration. Prominent ErbB4-positive migratory streams consisting of cells double-labeled with ErbB4 and Dlx, a marker of tangentially migrating cells, were found to advance along the lower intermediate zone and the marginal zone from the ventrolateral to the dorsomedial cortex at E16E18. After E20, the ErbB4-positive stream in the lower intermediate zone shifted towards the germinal zone and further extended via the cortex into the hippocampal primordium. ErbB4 was not expressed by Tbr1-positive glutamatergic projection neurons during development. ErbB4 was preferentially expressed by the majority of parvalbumin-positive interneurons and subsets of other GABAergic interneurons in the cerebral cortex and the hippocampus in adulthood. The early onset and preferential expression of ErbB4 in tangentially migrating interneurons suggests that neuregulin/ErbB4 signaling may regulate the development and function of telencephalic interneurons.
| Introduction |
|---|
|
|
|---|
GABAergic inhibitory interneurons play important roles in the control of neural activity in the cerebral cortex. The modulation of neural circuits by interneurons is essential to the proper functioning of the cerebral cortex (McBain and Fisahn, 2001
The epidermal growth factor (EGF) receptor family consists of four receptor tyrosine kinases, including the EGF receptors ErbB1, ErbB2, ErbB3 and ErbB4 (Burden and Yarden, 1997
; Gassmann and Lemke, 1997
; Adlkofer and Lai, 2000
; Garratt et al., 2000
; Buonanno and Fischbach, 2001
). The neuregulins (NRGs 14) have been identified as a family of EGF-domain-containing molecules that serve as ligands for the ErbBs (Holmes et al., 1992
; Peles et al., 1992
; Wen et al., 1992
; Falls et al., 1993
; Marchionni et al., 1993
; Busfield et al., 1997
; Carraway et al., 1997
; Chang et al., 1997
; Zhang et al., 1997
; Harari et al., 1999
). Activation of ErbB receptors through tyrosine phosphorylation has been shown to regulate cell proliferation, migration and differentiation in different neural systems (Burden and Yarden, 1997
; Adlkofer and Lai, 2000
; Buonanno and Fischbach, 2001
). For example, NRG-1 is a potent mitogen and survival factor for Schwann cells and is also capable of inducing acetylcholine receptor synthesis at the neuromuscular junction. NRG-1-mediated ErbB2 and ErbB4 activation promotes the neuron-primed elongation of radial glia and neuronal migration in the cerebellum and cerebral cortex during development (Anton et al., 1997
; Rio et al., 1997
).
Unlike ErbB2 and ErbB3, which appear to require heterodimerization for functional activation, ligand-induced homodimerization of ErbB4 is functionally competent in transducing NRG signals, which suggests that expression of ErbB4 by itself in neurons may be of functional significance (Plowman et al., 1993
). An understanding of the pattern of ErbB4 expression in the nervous system may facilitate our ability to decipher the neurobiological function of NRG/ErbB4 signaling. In the present study, we have investigated the ontogeny of ErbB4 expression in the dorsal telencephalon during development. ErbB4 protein was primarily expressed in interneuron progenitors that were undergoing tangential migration from the ganglionic eminences to the cerebral cortex and the hippocampus, and ErbB4 was expressed in different classes of cortical and hippocampal interneurons in adulthood. Our study suggests that ErbB4 signaling may be involved in regulating the development and function of telencephalic interneurons. Parts of the present study have been reported in abstract form elsewhere (Yau et al., 2001
).
| Materials and Methods |
|---|
|
|
|---|
Preparation of Brain Tissue
Embryos and pups from time-pregnant rats (SpragueDawley; National Yang-Ming University, Taipei, Taiwan) were used for brain tissue harvesting. The day of sperm positivity was designated as embryonic day (E) 1 and the day of birth as postnatal day (P) 0. Prenatal tissues were obtained from pregnant rats deeply anesthetized with sodium pentobarbital. For the ribonuclease protection assay, the tissues of the cerebral cortex were dissected from E15 (n = 3), E18 (n = 3), E20 (n = 3), P0 (n = 3), P7 (n = 2), P14 (n = 2) and adult brains (n = 2). For immunocytochemistry, brain tissues were obtained by immersion fixation of heads of E13 (n = 5), E14 (n = 7), E15 (n = 11) embryos and brains of E16 (n = 4), E17 (n = 4) and E18 embryos (n = 10), or by intra-cardiac perfusion of E20 embryos (n = 6). For all brain tissues, the fixative was ice-cold 2 or 4% paraformaldehyde in 0.1 M phosphate buffer (PB). For postnatal brain tissues, P0 (n = 3), P3 (n = 5), P7 (n = 3) and P14 (n = 2) rat pups and adult rats (n = 5) were anaesthetized by cooling on ice (P0, P3) or by i.p. injection of sodium pentobarbital (P7, P14, adult) and were then perfused transcardially with the same fixative. Heads of E13E15 embryos and E16E18 brains were immersed fixed at 4°C overnight. Brains of E20adults were post-fixed in the same fixative for 48 h and then cryoprotected at 4°C for at least 24 h in 20% glycerol in 0.1 M PB. Brains or whole heads were cut with a freezing microtome (Microtom, Germany) or a vibratome at 2040 µm in the coronal plane. All efforts were made to minimize both the suffering and the number of animals used. The protocol of animal use conformed to NIH guidelines for the care and use of laboratory animals.
Ribonuclease Protection Assay
The ErbB4 probe was generated by reverse transcriptionpolymerase chain reaction cloning. The 5' primer (GGAGCACTCTTCAGCACCCA) and 3' primer (GGTAGAAGGAAGACTGCCAG) corresponded to nucleotides 37823802 and 40464027, respectively, of the rat ErbB4 gene (Genebank Accession No. NM 021687). The product of ErbB4 was cloned into TA vector following the manufacturers instruction (Clontech, Palo Alto, CA). The ribonuclease protection assay was performed as previously described (Wang and Liu, 2001
). Briefly, plasmids containing the cloned ErbB4 fragments were linearized with HindIII restriction enzymes. Antisense RNA probes were generated and labeled with [32P]
-UTP (Dupont, NEN Life Science, Boston, MA) by in vitro transcription. The 32P-labeled antisense probes were hybridized to RNA and were then processed with RNase to digest single-strand RNA. Protected fragments were separated in 6% sequencing gel. The radioactivity of protected bands was quantified by scanning the protected fragments on a Phosphoimager 400S (Molecular Dynamic, Sunnyvale, CA). The results were analyzed using the ImageQuant software.
Western Blotting
The cerebral cortex and hippocampus were dissected out from P1 rat brains. Tissues were lysed and were further homogenized to obtain homogenates. Proteins were resolved on 5% SDSpolyacrylamide gels by electrophoresis and were then transferred to polyvinyldifluoride membranes (Immobilon-P; Millipore, Bedford, MA). Non-specific binding was blocked by incubating the blots with Tris-buffered saline containing 3% bovine serum albumin (BSA) and 10% normal goat serum (TBS) for 1.5 h. After rinses with TBS, blots were incubated with the primary antibody solution containing affinity-purified 0616 anti-ErbB4 antiserum (1:1000), or the 0616 antiserum preabsorbed with the antigen of ErbB4 fusion protein in TBS overnight at 4°C. After several rinses with TBS, blots were incubated with 1:10 000 goat anti-rabbit IgG conjugated with HRP (Cappel, Madison, WI) and blots were then processed with enhanced chemiluminescence (ECL Plus; Amersham Pharmacia Biotech Asia Pacific, Hong Kong).
Immunocytochemistry
Single Antigen Immunocytochemistry
Immunostaining was carried out by the avidinbiotin-peroxidase complex method (ABC) as previously described (Liu and Graybiel, 1992
). In brief, free-floating sections were rinsed 2 x 5 min with 0.1 M PB containing 0.9% saline (PBS) and were pretreated with 0.2% Triton X-100/0.1 M PBS for 15 min. Sections were incubated in 10% methanol, 3% H2O2 and 0.2% Triton X-100 in 0.1 M PBS for 5 min. Sections were then treated with 3% normal goat serum in 0.1 M PBS for 12 h. Each step was preceded by three washes in 0.1 M PBS. Sections were incubated in affinity-purified 0616 rabbit anti-ErbB4 antiserum (1:2000) in 0.1 M PBS containing 1% normal goat serum, 0.2% Triton X-100 and 0.1% azide at 4°C for 3648 h. After several rinses with 0.1 M PBS, sections were incubated successively with a biotin-conjugated goat anti-rabbit IgG (1:500; Vector Laboratories, Burlingame, CA) for 1 h and then with avidinbiotin-peroxidase complex (5 µl A and 5 µl B/ml, Elite kit; Vector Laboratories) for 1 h with two rinses of 0.1 M PB in between. Sections were incubated in 0.1 M PB containing 0.02% diaminobenzidine (DAB; Sigma, St Louis, MO) and 0.08% nickel ammonium sulfate. Immunostaining was developed by adding H2O2 to a final concentration of 0.0018%. Sections were mounted, air dried, dehydrated, covered with coverslips and analyzed with light microscopy. Negative controls for the immunostaining were performed by incubating sections without primary antibody. No staining was present in the sections of negative controls.
Double Antigen Immunocytochemistry
Double immunocytochemistry was performed as previously described (Wang and Liu, 2001
). For double immunofluorescence staining, brain sections were first incubated in primary antibody solution containing 0616 anti-ErbB4 antiserum (1:400), 1% normal goat serum, 0.2% Triton X-100 and 0.1% azide at 4°C for 3648 h. After several rinses with 0.1 M PBS, sections were incubated in the secondary antibody of Cy3-conjugated donkey anti-rabbit IgG (1:1000; Jackson Laboratories, West Grove, PA) for 12 h. After extensive rises with 0.1 M PB, the sections were treated with 3% normal goat serum in 0.1 M PBS and were then incubated with mouse monoclonal anti-parvalbumin (1:2000; Sigma), anti-calretinin (1:1000; Sigma), anti-neuronal nNOS (1:2000; Sigma) or anti-calcium calmodulin-dependent protein kinase II antibodies (1:200; Boehringer Mannheim, Indianapolis, IN) at 4°C for 3648 h. The sections were washed several times with 0.1 M PB and were then incubated with 5-(4,6-dichlorotriazinyl)aminofluorescein (DTAF)-conjugated goat anti-mouse secondary antibody (1:500, Jackson Laboratories) for 12 h. For double labeling of Tbr1, Dlx or somatostatin with ErbB4, as these antisera were all derived from the rabbit sera, we followed the protocol of Shindler and Roth (Shindler and Roth, 1996
) to double label sections using antibodies of the same species with the tyramide signal amplification system. The sections were first processed for Tbr1 or Dlx immunofluorescent staining with anti-Tbr1 antiserum (1:10 000, kindly provided by Dr Y.-P. Hsueh, Academia Sinica, Taipei, Taiwan) or with anti-distal-less class antiserum (1:10 000, kindly provided by Dr G. Panganiban, University of Wisconsin) using the tyramide amplification method. The sections were then processed for ErbB4 immunofluorescent staining by the standard method. For ErbB4 and somatostatin double labeling, sections were first processed for ErbB4 immunofluorescent staining with the tyramide amplification method (anti-ErbB4 antiserum 1:5000), followed by standard immunofluorescent staining with anti-somatostatin antiserum (1:2000, kindly provided by R. Elde, University of Minnesota). The pattern of double immunofluorescent staining was studied with the aid of a laser confocal microscope (Leica, Germany). Controls for the specificity of double immunostaining were determined by omission of one of the primary antibodies in the staining process. Elimination of the primary antibody resulted in a loss of immunofluorescence.
Quantitative Cell Counting
The quantitative measurements of cells expressing ErbB4 and interneuron markers and of cells expressing ErbB4 and projection neuron markers were carried out by counting single and double-labeled cells within a 10 mm2 reticule. For regional sampling in the cerebral cortex, the reticules were placed in the frontal cortex, the parietal cortex and the granular insular cortex of adult rat brain sections. For the hippocampus, all labeled cells were counted. The labeled cells from the sampled regions were pooled for statistical analyses. The data represented the cell counts from two adult rats.
| Results |
|---|
|
|
|---|
Developmental Expression of ErbB4 mRNA in the Cerebral Cortex of Rats
To determine whether ErbB4 mRNA was expressed in the telencephalon during development, we used a ribonuclease protection assay to measure the expression levels of ErbB4 mRNA in the cerebral cortex throughout development. This assay detected a band of ~265 bp that corresponded to the predicted size of the protected fragment of the ErbB4 transcript (Fig. 1
). The expression of ErbB4 mRNA in the developing cortex followed a dynamic pattern. The ErbB4 mRNA was not detectable in the cortical primordium at E15. The expression levels of ErbB4 mRNA dramatically increased from E18 to E20 and peaked at P0. The expression levels then gradually decreased from P0 to P7 to P14 to adulthood (Fig. 1
). This profile suggested that ErbB4 expression in the cortex was developmentally regulated.
|
Expression of ErbB4 in Tangential Migratory Streams from the Ventral to Dorsal Telencephalon during Development
To investigate further the developmental regulation of ErbB4 expression at the cellular level, we analyzed the expression of ErbB4 protein in the developing rat telencephalon using immunocytochemistry. We first characterized the specificity of the affinity-purified ErbB4 antiserum (0616) in the developing rat telencephalon by using Western blots. The results showed that a single band of ~185 kDa, corresponding to the mol. wt of ErbB4 protein, was detected in tissue extracts prepared from the neocortex and hippocampus of P1 rats (Fig. 2
). The detection of the 185 kDa band was specific, as it was not present in the pre-adsorption control in which the antiserum was first incubated with the immunogen. The specificity of the ErbB4 antiserum for immunocytochemical analyses was also demonstrated by preadsorption, which led to the virtual elimination of ErbB4 immunostaining in embryonic and postnatal brain tissues (data not shown). Staining was absent in the negative control in which brain sections were processed without the primary antiserum.
|
Early Ontogeny of ErbB4 Expression in the Rat Telencephalon: E13E15
E13 Telencephalon
ErbB4 immunoreactivity was not detected in the dorsal telencephalon, except in the primordium of the choroid plexus at E13, the earliest developmental stage examined. In contrast, ErbB4 immunoreactivity was detected in the medial ganglionic eminence (MGE) of the ventral telencephalon (Fig. 3A
). In the MGE, weak ErbB4 immunoreactivity was observed in the most lateral part of the ganglionic eminence, which presumably corresponded to the differentiated region (Fig. 3B
). As a result of the weak signals, the cellular details of ErbB4 immunostaining were not clearly discernible. ErbB4 immunoreactivity was absent from the ventricular zone (Fig. 3B
).
|
E14 Telencephalon
The cortical primordium remained negative for ErbB4 immunostaining. High levels of ErbB4 immunoreactivity were found in the MGE (Fig. 3C
). Numerous ErbB4-positive cells were present throughout the MGE, except in the ventricular zone where few ErbB4-positive cells were detected (Fig. 3D
). In addition to the MGE, another developmental structure, the lateral ganglionic eminence (LGE), appeared rostrolaterally to the MGE in the ventral telencephalon at this developmental stage. Notably, an ErbB4-positive stream was detected in the LGE (Fig. 3D
). Although the cellular details of this ErbB4-positive stream were not clearly discernible, it appeared to originate from the MGE, as the stream could be continuously traced across the LGE back to the MGE proper (Fig. 3D
). This stream-like ErbB4 expansion in the ganglionic eminences was similar to the previously reported early phase of the tangential migratory pathway from the ventral to dorsal telencephalon (Anderson et al., 2001
; Marin and Rubenstein, 2001
; Marin et al., 2001
). Thus, it represented the first sign that ErbB4 might be expressed by tangentially migrating cells as early as when the cells start to leave the MGE and begin to move upward toward the dorsal telencephalon.
E15 Telencephalon
At E15, the structure of the LGE became evident and many ErbB4-positive cells were detected in the ventral part of LGE, whereas only a few scattered ErbB4-positive cells were found in the dorsal LGE (Fig. 3E,F
). Two lines of observation suggested that ErbB4-positive cells in the LGE were in the process of migrating from the LGE to the overlying cerebral cortex. First, there was a loosely organized stream of ErbB4-positive cells that extended from the LGE upward into the cerebral cortex. A few ErbB4-positive cells evidently crossed the boundary between the LGE and the cerebral cortex (Fig. 3F
). Secondly, the ErbB4-positive cells in the stream contained tangentially oriented leading processes pointing in the direction of the overlying cerebral cortex (Fig. 3F
). It is notable that at this developmental stage, ErbB4-positive cells have not yet migrated extensively into the overlying cortex. They were mainly located at the border between the pallium (cerebral cortex) and subpallium (LGE). In parallel to this pathway, another ErbB4-positive stream appeared to advance along the marginal zone (Fig. 3F
).
Expression of ErbB4 in Cells of Tangential Migratory Streams: E16E20
E16 Telencephalon
Beginning at E16, two prominent ErbB4-positive streams were found to extend from the LGE into the cerebral cortex (Fig. 4A
). These ErbB4-positive migratory streams advanced mainly along the lower part of the intermediate zone and the marginal zone of the cortical primordium. These two streams comprised many ErbB4-positive cells with non-radially oriented processes (Fig. 4B,C
). In contrast to E15, the streams of ErbB4-positive cells had advanced deeply into the overlying cerebral cortex by E16. Of particular interest was that the ErbB4-positive cells climbed roughly half of the extent of the lateral cortex, so that no ErbB4-positive cells were yet present in the dorsomedial cortex (Fig. 4A
). This distribution pattern of ErbB4-positive cells in the cortical anlage was similar to that previously observed for migrating cells expressing GABA (Lauder et al., 1986
; Van Eden et al., 1989
; DeDiego et al., 1994
). This similarity further supported the idea that ErbB4 was expressed in tangentially migrating GABAergic interneurons.
|
E17 Telencephalon
A striking ErbB4-positive migratory stream extending from the base of telencephalon across the subventricular zone of ganglionic eminences could be continuously traced up to the dorsal part of the cerebral cortex (Fig. 4D
). In addition to the ErbB4-positive stream in the lower intermediate zone, another ErbB4-positive stream containing many strongly positive cells appeared along the marginal zone of the cortical primordium. This stream was likely to be a continuous extension of ErbB4-positive cells from the MGE via the piriform cortex (Fig. 3E,F
). Of particular note was that the ErbB4-positive streams in the lower intermediate zone and marginal zone appeared to move upward into the cortex in a synchronized manner, i.e. beginning from E15 to E18, the front waves of both ErbB4-positive streams were located at similar positions along the dorsoventral axis of the cortex (Figs 3E,F
and 4A,D
). These findings suggested that up until E18 (see below), there were two distinct tangential migratory routes, the lower intermediate zone and the marginal zone. ErbB4 was expressed by migrating cells of both pathways.
E18 Telencephalon
By E18, both ErbB4-positive streams extended extensively into the cortex, except into the medial cortex in which only a few ErbB4-positive cells were found to invade the hippocampal primordium (Fig. 5A,C
). This suggested that ErbB4-positive cells in the cortex and the hippocampus might share a common origin (Pleasure et al., 2001
). Along the migratory route of the lower intermediate zone, a number of ErbB4-positive cells appeared to depart from the stream and move into the upper parts of the intermediate zone (Fig. 5B
). Notably, ErbB4-positive cells were also found in the ventricular zone and some of them had their leading processes oriented towards the ventricular zone.
|
E20 Telencephalon
At this developmental stage, the ErbB4-positive migratory stream appeared to be shifted from the lower intermediate zone towards the subventricular/ventricular zone. The stream extended from the ganglionic eminence via the cerebral cortex into the hippocampal primordium (Figs 5D,F
and 7A
). This pathway corresponded to the previously described late phase migratory route (Anderson et al., 2001
). Many ErbB4-positive cells were distributed across the entire cortical primordium from the ventricular zone to the marginal zone (Fig. 5E
).
|
At caudal levels, strong ErbB4 immunostaining in the germinal zone appeared to expand into the primordium of the bed nucleus of stria terminalis where numerous strongly ErbB4-positive cells were present (Fig. 7A
Regression of the ErbB4-positive Migratory Pathway during Postnatal Development
P0P7 Telencephalon
ErbB4-positive immunostaining remained in the germinal zone of the developing striatum and cortex. Many bipolar ErbB4-positive cells were present in the cortical plate of P0P3 cortex (Fig. 6A
). There were also ErbB4-positive cells in the white matter of the corpus callosum. By P7, the ErbB4 immunoreactivity in the germinal zone of the lateral ventricle was significantly reduced. Many ErbB4-positive cells were still detected in the cortex (Fig. 6B
).
|
P14 and Adult Telencephalon
The perikaryal staining of ErbB4-positive cells appeared to be enhanced such that the morphology of the cells was well delineated at P14 (Fig. 6C
). ErbB4-positive cells were scattered through the cerebral cortex in adulthood (Fig. 6D
).
Co-expression of ErbB4 and Dlx, but not Tbr1 in Tangentially Migrating Cells
The transcription factor dlx is a reliable marker for tangentially migrating GABAergic interneurons, as evidenced by its selective and extensive expression in cells of the tangentially migratory stream (Anderson et al., 1997
; Stuhmer et al., 2002
). To determine the extent to which ErbB4 was expressed by the population of tangentially migrating neurons, we performed a double label immunostaining for ErbB4 and Dlx. Our results indicated that most of the ErbB4-positive cells in the tangentially migratory stream co-expressed Dlx protein (as recognized by an anti-distal-less class antibody) in the E18 and E20 telencephalon (see Fig. 7B
) (Panganiban et al., 1995
). The extensive co-localization of ErbB4 and Dlx was also observed in the cortical plate, where many ErbB4-positive cells were detected (Fig. 7C
).
To test whether ErbB4 was expressed in cortical projection neurons that derived from radial migration, we performed a double labeling using ErbB4 and Tbr1, a putative transcription factor that is expressed in early-born glutamatergic projection neurons (Hevner et al., 2001
). In contrast to the extensive co-localization of ErbB4 and Dlx, few cells co-expressing ErbB4 and Tbr1 were found in the E18 and E20 cortical primordium (Fig. 7D
). This lack of co-localization of ErbB4 and Tbr1 was also observed at P3, P7 and in the adult cerebral cortex (Fig. 7E
). Together, these results unequivocally demonstrated that ErbB4 was expressed by the majority of cells in the process of migrating tangentially from the ganglionic eminences to the cerebral cortex during development.
Expression of ErbB4 in Interneurons of the Cerebral Cortex and the Hippocampus in Adult Rat Brains
It has been shown that GABAergic interneurons in the cerebral cortex and hippocampus are derived from tangentially migrating neurons originating from the ganglionic eminences in developing rodent brains (Anderson et al., 1997
, 2001
, 2002
; Tamamaki et al., 1997
; Lavdas et al., 1999
; Wichterle et al., 1999
, 2001
; Jimenez et al., 2002
; Stuhmer et al., 2002
). Our finding of ErbB4 expression in tangentially migrating cells thus led to the prediction that ErbB4 would be expressed by interneurons of the cortex and hippocampus. In accordance with this prediction, early work by Lais group had suggested that ErbB4 is expressed by dispersed GABAergic interneurons in the adult cortex and hippocampus (Lai and Lemke, 1991
; Weber et al., 1996
). We therefore asked whether ErbB4 was expressed by specific subsets of GABAergic interneurons in the cortex and hippocampus in adult brains. We performed a double-labeling analysis using anti-ErbB4 serum and markers for cortical GABAergic interneuron subtypes, including parvalbumin, calretinin, nNOS and somatostatin. We found that ErbB4 was preferentially co-localized with parvalbumin in the cerebral cortex (Fig. 7F
). The quantitative cell counts indicated that 88.3% of parvalbumin-positive neurons co-expressed ErbB4 (Table 1
). Notably, the double-labeled parvalbumin- and ErbB4-positive neurons could account for 77.4% of the total ErbB4-positive neuronal population, while 5.4, 3.9 and 1.61% were accounted for by calretinin-positive, somatostatin-positive and nNOS-positive neurons, respectively (Fig. 7F
H, Table 1
). In contrast to parvalbumin, 15.6, 6.3 and 21.4% of calretinin-positive, somatostatin-positive and nNOS-positive neurons co-expressed ErbB4, respectively (Table 1
).
|
The co-expression profile of ErbB4 and interneuron markers in the adult hippocampus was similar to that observed in the cortex, with parvalbumin-positive neurons being the major subtype of interneurons that co-expressed ErbB4 (56%, Table 2
|
To test the possibility that, in addition to interneurons, ErbB4 might also be expressed in glutamatergic projection neurons in the adult cortex, we double immunostained ErbB4 and calcium calmodulin-dependent protein kinase II (CaMKII), which is expressed in cortical projection neurons (Liu and Jones, 1996
| Discussion |
|---|
|
|
|---|
It has been well documented that most GABAergic interneurons in the cerebral cortex and hippocampus are derived from tangentially migrating neurons in the ventral telencephalon of rodents (Parnavelas, 2000
Expression of ErbB4 in Tangentially Migrating Cells from the Ventral to Dorsal Telencephalon
Our study suggests that there are at least two ErbB4-positive migratory pathways from the ventral to dorsal telencephalon. ErbB4-positive cells were found to advance along the lower intermediate zone and marginal zone from the ganglionic eminences to the cerebral cortex and the hippocampus from E13 to E20 (Fig. 8
). Evidence suggesting ErbB4 was expressed in migrating cells was supported by the finding that ErbB4-positive cells co-expressed Dlx, a marker for tangentially migrating cells (Stuhmer et al., 2002
). Due to the rapid expansion of cortical tissue, the ErbB4-positive migratory pathways in the lower intermediate zone may be gradually displaced towards the germinal zone after E20. Some of the ErbB4-positive cells found in the ventricular zone had their leading processes oriented towards the ventricular zone. This is of interest, as a ventricle-directed migration has recently been characterized in tangentially migrating interneurons (Nadarajah et al., 2002
). The ErbB4-positive migratory pathways described in the present study are consistent with the previously documented tangentially migratory pathways in the developing rodent telencephalon (De Carlos et al., 1996
; Anderson et al., 1997
, 2001
; Tamamaki et al., 1997
; Lavdas et al., 1999
; Wichterle et al., 1999
, 2001
; Jimenez et al., 2002
; Shinozaki et al., 2002
).
|
Our study indicated that ErbB4 was not co-localized with Tbr1, a marker for early-born glutamatergic projection neurons in the cortex (Hevner et al., 2001
Our present study did not address the question of whether other members of the ErbB family were also expressed in tangentially migrating cells. Previous studies have shown that the EGF receptor (ErbB1) and ErbB2 mRNA are primarily expressed in the ventricular zone, whereas ErbB4 mRNA is expressed in the subventricular zone at early stages of development (Pinkas-Kramarski et al., 1997
; Kornblum et al., 2000
; Calaora et al., 2001
). ErbB3 mRNA is mainly expressed in the neuroepithelium of the diencephalon and rostral midbrain (Pinkas-Kramarski et al., 1997
; Kornblum et al., 2000
; Calaora et al., 2001
). Taken together, it is likely that ErbB4 is the primary neuregulin receptor expressed by tangentially migrating cells, which highlights the potential biological significance of ErbB4 in transducing neuregulin signals critical for interneuron development and function.
Potential Function of ErbB4 Signaling in Cells Undergoing Tangential Migration
The expression of ErbB4 in migrating cells that form the tangential migratory routes of the developing telencephalon suggests that ErbB4 ligands may be detected nearby. The ligands of ErbB4 include NRG-1, NRG-2, NRG-3, NRG-4, heparin-binding epidermal growth factor (HB-EGF), betacellulin and epiregulin (Riese et al., 1996
; Elenius et al., 1997
; Komurasaki et al., 1997
; Buonanno and Fischbach, 2001
). NRG-1 has been shown to be present in the ganglionic eminences and developing cortex (Pinkas-Kramarski et al., 1994
; Meyer et al., 1997
; Calaora et al., 2001
). NRG-2 is expressed in the adult brain, whereas NRG-3, which binds specifically to ErbB4, is expressed at high levels in the developing forebrain (Carraway et al., 1997
; Zhang et al., 1997
). NRG-4, despite its specificity for binding to ErbB4, is not found in the adult nervous system (Harari et al., 1999
; C. Lai, unpublished observations). HB-EGF is expressed in the developing cortical plate, while less is known about the expression of betacellulin and epiregulin in the developing brain (Kornblum et al., 1999
). Therefore, ErbB ligands including NRG-1, NRG-3 and HB-EGF are candidate molecules that could potentially activate ErbB4 homodimers and/or ErbB4-containing heterodimers in tangentially migrating cells. The activation of ErbB4 by different ligands may result in different biological responses, as stimulation of ErbB4 with different ligands has been shown to result in recruiting distinct intracellular signal molecules with different biological potencies (Sweeney et al., 2000
).
The early onset of ErbB4 expression, which is detected as soon as the cells start migrating tangentially, suggests that activation of ErbB4 signaling may be important for the early stages of interneuron development. It is of particular interest that ErbB4 is expressed in several brain regions where tangential migration takes place. The rostral migratory stream extends from the striatal subventricular zone down to the olfactory bulbs. Previous studies have indicated that progenitors of the subventricular zone of the adult striatum and of the LGE migrate tangentially along this rostral pathway to give rise to GABAergic interneurons in the olfactory bulb (Bulfone et al., 1998
; Goldman and Luskin, 1998
; Wichterle et al., 1999
, 2001
; Parnavelas, 2000
). The expression of ErbBs has been described in the rostral migratory stream (Steiner et al., 1999
; Weber et al., 2000
). In addition to the forebrain, tangential migration also occurs in the hindbrain during development. It has been shown that ErbB4 is expressed in progenitors of the pontine nucleus and inferior olive while they undergo tangential migration from the rhombic lip of the dorsal hindbrain down to their destination in the ventral hindbrain (Gassmann et al., 2001
; Yee and OLeary, 2001
). Thus, the expression of ErbB4 appears to be correlated with tangentially migrating neuronal populations located in several brain regions during development. These coincidences suggest that ErbB4 signal transduction may be involved in the process of non-radial tangential migration in the developing telencephalon. It has been previously shown that NRG/ErbB signaling is involved in neuronal migration in the developing nervous system. Activation of ErbB4 signaling by NRG has been shown to regulate the migration of granule cells along radial glia in the developing cerebellum (Rio et al., 1997
). In addition, NRG/ErbB2 signaling has been reported to be important for proper radial migration of cortical cells (Anton et al., 1997
). In both cases, migration is radial-glia dependent. Separately, the abnormal non-radial migration of a subset of cranial neural crest cells, has been detected in ErbB4-null mutant mice, though the migratory defect is not cell-autonomous (Golding et al., 2001
). The possibility that the activation of ErbB4 signaling may regulate the molecular machinery underlying tangential migration and that radial and tangential migration may be mechanistically related are interesting topics for future study.
Preferential Expression of ErbB4 by GABAergic Interneurons in the Cerebral Cortex and Hippocampus
Previous studies by Lai and his co-workers have shown that ErbB4 (tyro2) mRNAs are expressed by dispersed GABAergic neurons in the cortex and hippocampus (Lai and Lemke, 1991
; Weber et al., 1996
). Our present study further demonstrates that ErbB4 protein is expressed in specific populations of GABAergic interneurons in the cerebral cortex and hippocampus. One of the most interesting findings in our study is that ErbB4 is highly associated with parvalbumin-positive interneurons in the cortex and hippocampus. Our quantitative data show that 88.3 and 81.8% of parvalbumin-positive interneurons in the cortex and hippocampus, respectively, express ErbB4. In addition to the cerebral cortex and hippocampus, the high degree of co-localization of ErbB4 in parvalbumin-positive interneurons also occurs in the striatum (H.-J. Yau, H.-F. Wang, C. Lai and F.-C. Liu, unpublished observations). These findings suggest that parvalbumin-positive neurons in the telencephalon, including the cerebral cortex, the hippocampus and the striatum, may be derived from the same progenitor population originating from the ganglionic eminences during development. Consistent with this hypothesis, parvalbumin-positive interneurons in both the cortex and the striatum share expression of several molecules, including the NMDA receptor subunit 2D and the potassium channel subunit Kv3.1 (Lenz et al., 1994
; Chow et al., 1999
). ErbB4 is also expressed in subsets of other GABAergic interneurons, including calretinin, somatostatin and nNOS in the cerebral cortex and hippocampus in adulthood. NRG/ErbB4 signaling may regulate cellular properties associated with GABAergic interneurons. For example, recent work indicates that NRG-1-ß1 can increase the expression of nicotinic acetylcholine receptor subunit alpha7 and excitatory synaptic transmission in GABAergic interneurons in hippocampal neurons (Liu et al., 2001
). However, it is not yet clear from this study through which types of ErbB receptors the NRG-1-ß1 effects are mediated. NRGs have also been shown to be capable of inducing the NMDA receptor subunit NR2C in the cerebellar slice culture and the GABAa receptor subunit beta2 in cerebellar granular cell culture (Ozaki et al., 1997
; Rieff et al., 1999
).
It is of particular interest that recent genetic study in schizophrenia families has linked the nrg-1 locus to the pathogenesis of schizophrenia (Stefansson et al., 2002
), a complex neurological disorder that may have neurodevelopmental roots (Lewis and Levitt, 2002
). Moreover, nrg-1 or ErbB4 heterozygous mutant mice have behavioral abnormalities similar to mouse models of schizophrenia (Stefansson et al., 2002
). Intriguingly, abnormality of cortical GABAergic interneurons has also been implicated in the etiology of schizophrenia (Benes and Berretta, 2001
). Given the early onset of ErbB4 expression and the preferential expression of ErbB4 in GABAergic interneurons, activation of ErbB4 signaling may play an important role in regulating the development and function of telencephalic interneurons.
| Footnotes |
|---|
We thank Drs R. Elde, Y.-P. Hsueh and G. Panganiban for somatostatin, Tbr1 and Dlx antibodies, respectively and M.-J. Fanns laboratory for help with the Western blotting. This work was supported by NSC 90-2311-B-010-012, NHRI-EX90-9010NL (F.-C.L.), NIH R01NS32367 and NIH R01NS39411 (C.L.).
| References |
|---|
|
|
|---|
Adlkofer K, Lai C (2000) Role of neuregulins in glial cell development. Glia 29:104111.[CrossRef][Web of Science][Medline]
Anderson SA, Eisenstat DD, Shi L, Rubenstein JL (1997) Interneuron migration from basal forebrain to neocortex: dependence on Dlx genes. Science 278:474476.
Anderson SA, Marin O, Horn C, Jennings K, Rubenstein JL (2001) Distinct cortical migrations from the medial and lateral ganglionic eminences. Development 128:353363.[Abstract]
Anderson SA, Kaznowski CE, Horn C, Rubenstein JL, McConnell SK (2002) Distinct origins of neocortical projection neurons and interneurons in vivo. Cereb Cortex 12:702709.
Anton ES, Marchionni MA, Lee KF, Rakic P (1997) Role of GGF/ neuregulin signaling in interactions between migrating neurons and radial glia in the developing cerebral cortex. Development 124:35013510.[Abstract]
Benes FM, Berretta S (2001) GABAergic interneurons: implications for understanding schizophrenia and bipolar disorder. Neuropsycho-pharmacology 25:127.[CrossRef][Web of Science][Medline]
Bulfone A, Wang F, Hevner R, Anderson S, Cutforth T, Chen S, Meneses J, Pedersen R, Axel R, Rubenstein JL (1998) An olfactory sensory map develops in the absence of normal projection neurons or GABAergic interneurons. Neuron 21:12731282.[CrossRef][Web of Science][Medline]
Buonanno A, Fischbach GD (2001) Neuregulin and ErbB receptor signaling pathways in the nervous system. Curr Opin Neurobiol 11:287296.[CrossRef][Web of Science][Medline]
Burden S, Yarden Y (1997) Neuregulins and their receptors: a versatile signaling module in organogenesis and oncogenesis. Neuron 18:847855.[CrossRef][Web of Science][Medline]
Busfield SJ, Michnick DA, Chickering TW, Revett TL, Ma J, Woolf EA, Comrack CA, Dussault BJ, Woolf J, Goodearl AD, Gearing DP (1997) Characterization of a neuregulin-related gene, Don-1, that is highly expressed in restricted regions of the cerebellum and hippocampus. Mol Cell Biol 17:40074014.[Abstract]
Calaora V, Rogister B, Bismuth K, Murray K, Brandt H, Leprince P, Marchionni M, Dubois-Dalcq M (2001) Neuregulin signaling regulates neural precursor growth and the generation of oligodendrocytes in vitro. J Neurosci 21:47404751.
Carraway KL, Weber JL, Unger MJ, Ledesma J, Yu N, Gassmann M, Lai C (1997) Neuregulin-2, a new ligand of ErbB3/ErbB4-receptor tyrosine kinases. Nature 387:512516.[CrossRef][Medline]
Cauli B, Audinat E, Lambolez B, Angulo MC, Ropert N, Tsuzuki K, Hestrin S, Rossier J (1997) Molecular and physiological diversity of cortical nonpyramidal cells. J Neurosci 17:38943906.
Chang H, Riese DJ, Gilbert W, Stern DF, McMahan UJ (1997) Ligands for ErbB-family receptors encoded by a neuregulin-like gene. Nature 387:509512.[CrossRef][Medline]
Chow A, Erisir A, Farb C, Nadal MS, Ozaita A, Lau D, Welker E, Rudy B (1999) K+ channel expression distinguishes subpopulations of parvalbumin- and somatostatin-containing neocortical interneurons. J Neurosci 19:93329345.
Corbin JG, Nery S, Fishell G (2001) Telencephalic cells take a tangent: non-radial migration in the mammalian forebrain. Nat Neurosci 4:11771182.[CrossRef][Web of Science][Medline]
De Carlos JA, Lopez-Mascaraque L, Valverde F (1996) Dynamics of cell migration from the lateral ganglionic eminence in the rat. J Neurosci 16:61466156.
DeDiego I, Smith-Fernandez A, Fairen A (1994) Cortical cells that migrate beyond area boundaries: characterization of an early neuronal population in the lower intermediate zone of prenatal rats. Eur J Neurosci 6:983997.[CrossRef][Web of Science][Medline]
Elenius K, Paul S, Allison G, Sun J, Klagsbrun M (1997) Activation of HER4 by heparin-binding EGF-like growth factor stimulates chemotaxis but not proliferation. EMBO J 16:12681278.[CrossRef][Web of Science][Medline]
Falls DL, Rosen KM, Corfas G, Lane WS, Fischbach GD (1993) ARIA, a protein that stimulates acetylcholine receptor synthesis, is a member of the neu ligand family. Cell 72:801815.[CrossRef][Web of Science][Medline]
Garratt AN, Britsch S, Birchmeier C (2000) Neuregulin, a factor with many functions in the life of a Schwann cell. Bioessays 22:987296.[CrossRef][Web of Science][Medline]
Gassmann M, Lemke G (1997) Neuregulins and neuregulin receptors in neural development. Curr Opin Neurobiol 7:8792.[CrossRef][Web of Science][Medline]
Gassmann M, Golding J, Tsoni V, Lumsden A, Dixon M (2001) Role of ErbB4 receptor tyrosine kinase in vertebrate hindbrain development. Soc Neurosci Abstr 27:692.8.
Golding JP, Trainor P, Krumlauf R, Gassmann M (2001) Defects in pathfinding by cranial neural crest cells in mice lacking the neuregulin receptor ErbB4. Nat Cell Biol 2:103109.
Goldman SA, Luskin MB (1998) Strategies utilized by migrating neurons of the postnatal vertebrate forebrain. Trends Neurosci 21:107114.[CrossRef][Web of Science][Medline]
Gupta A, Wang Y, Markram H (2000) Organizing principles for a diversity of GABAergic interneurons and synapses in the neocortex. Science 287:273278.
Harari D, Tzahar E, Romano J, Shelly M, Pierce JH, Andrews GC, Yarden Y (1999) Neuregulin-4: a novel growth factor that acts through the ErbB-4 receptor tyrosine kinase. Oncogene 18:26812689.[CrossRef][Web of Science][Medline]
Hevner RF, Shi L, Justice N, Hsueh Y, Sheng M, Smiga S, Bulfone A, Goffinet AM, Campagnoni AT, Rubenstein JL (2001) Tbr1 regulates differentiation of the preplate and layer 6. Neuron 29:353366.[CrossRef][Web of Science][Medline]
Holmes WE, Sliwkowski MX, Akita RW, Henzel WJ, Lee J, Park JW, Yansura D, Abadi N, Raab H, Lewis GD, Shepard M, Wood WI, Goeddel DV, Vandlen RL (1992) Identification of heregulin, a specific activator of p185erbB2. Science 256:12051210.
Jimenez D, Lopez-Mascaraque LM, Valverde F, De Carlos JA (2002) Tangential migration in neocortical development. Dev Biol 244: 155169.[CrossRef][Web of Science][Medline]
Kaplan DR, Miller FD (2000) Neurotrophin signal transduction in the nervous system. Curr Opin Neurobiol 10:381391.[CrossRef][Web of Science][Medline]
Kawaguchi Y, Kubota Y (1997) GABAergic cell subtypes and their synaptic connections in rat frontal cortex. Cereb Cortex 7:476486.
Knoll B, Drescher U (2002) Ephrin-As as receptors in topographic projections. Trends Neurosci 25:145149.[CrossRef][Web of Science][Medline]
Komurasaki T, Toyoda H, Uchida D, Morimoto S (1997) Epiregulin binds to epidermal growth factor receptor and ErbB-4 and induces tyrosine phosphorylation of epidermal growth factor receptor, ErbB-2, ErbB-3 and ErbB-4. Oncogene 15:28412848.[CrossRef][Web of Science][Medline]
Kornblum HI, Zurcher SD, Werb Z, Derynck R, Seroogy KB (1999) Multiple trophic actions of heparin-binding epidermal growth factor (HB-EGF) in the central nervous system. Eur J Neurosci 11: 32363246.[CrossRef][Web of Science][Medline]
Kornblum HI, Yanni DS, Easterday MC, Seroogy KB (2000) Expression of the EGF receptor family members ErbB2, ErbB3, and ErbB4 in germinal zones of the developing brain and in neurosphere cultures containing CNS stem cells. Dev Neurosci 22:1624.[CrossRef][Web of Science][Medline]
Lai C, Lemke G (1991) An extended family of protein-tyrosine kinase genes differentially expressed in the vertebrate nervous system. Neuron 6:691704.[CrossRef][Web of Science][Medline]
Lauder JM, Han VK, Henderson P, Verdoorn T, Towle AC (1986) Prenatal ontogeny of the GABAergic system in the rat brain: an immunocytochemical study. Neuroscience 19:465493.[CrossRef][Web of Science][Medline]
Lavdas AA, Grigoriou M, Pachnis V, Parnavelas JG (1999) The medial ganglionic eminence gives rise to a population of early neurons in the developing cerebral cortex. J Neurosci 19:78817888.
Lenz S, Perney TM, Qin Y, Robbins E, Chesselet MF (1994) GABA-ergic interneurons of the striatum express the Shaw-like potassium channel Kv3.1. Synapse 18:5566.[CrossRef][Web of Science][Medline]
Letinic K, Zoncu R, Rakic P (2002) Origin of GABAergic neurons in the human neocortex. Nature 417:645649.[CrossRef][Medline]
Lewis DA, Levitt P (2002) Schizophrenia as a disorder of neurodevelopment. Annu Rev Neurosci 25:409432.[CrossRef][Web of Science][Medline]
Liu F-C, Graybiel AM (1992) Transient calbindin-D28K-positive systems in the telencephalon: ganglionic eminence, developing striatum and cerebral cortex. J Neurosci 12:674690.[Abstract]
Liu XB, Jones EG (1996) Localization of alpha type II calcium calmodulin-dependent protein kinase at glutamatergic but not gamma-aminobutyric acid (GABAergic) synapses in thalamus and cerebral cortex. Proc Natl Acad Sci USA 93:73327336.
Liu Y, Ford B, Mann MA, Fischbach GD (2001) Neuregulins increase alpha7 nicotinic acetylcholine receptors and enhance excitatory synaptic transmission in GABAergic interneurons of the hippocampus. J Neurosci 21:56605669.
McBain CJ, Fisahn A (2001) Interneurons unbound. Nat Rev Neurosci 2:1123.[Web of Science][Medline]
Marchionni MA, Goodearl AD, Chen MS, Bermingham-McDonogh O, Kirk C, Hendricks M, Danehy F, Misumi D, Sudhalter J, Kobayashi K, Wroblewski D, Lynch C, Baldassare M, Hiles I, Davis JB, Hsuan JJ, Totty NF, Otsu M, McBurney RN, Waterfield MD, Stroobant P, Gwynne D (1993) Glial growth factors are alternatively spliced erbB2 ligands expressed in the nervous system. Nature 362:312318.[CrossRef][Medline]
Marin O, Rubenstein JL (2001) A long, remarkable journey: tangential migration in the telencephalon. Nat Rev Neurosci 2:780790.[Web of Science][Medline]
Marin O, Yaron A, Bagri A, Tessier-Lavigne M, Rubenstein JL (2001) Sorting of striatal and cortical interneurons regulated by semaphorin neuropilin interactions. Science 293:872875.
Meyer D, Yamaai T, Garratt A, Riethmacher-Sonnenberg E, Kane D, Theill LE, Birchmeier C (1997) Isoform-specific expression and function of neuregulin. Development 124:35753586.[Abstract]
Mione MC, Cavanagh JF, Harris B, Parnavelas JG (1997) Cell fate specification and symmetrical/asymmetrical divisions in the developing cerebral cortex. J Neurosci 17:20182029.
Nadarajah B, Parnavelas JG (2002) Modes of neuronal migration in the developing cerebral cortex. Nat Rev Neurosci 3:423432.[Web of Science][Medline]
Nadarajah B, Alifragis P, Wong RO, Parnavelas JG (2002) Ventricle-directed migration in the developing cerebral cortex. Nat Neurosci 5:218224.[CrossRef][Web of Science][Medline]
Ozaki M, Sasner M, Yano R, Lu HS, Buonanno A (1997) Neuregulin-beta induces expression of an NMDA-receptor subunit. Nature 390: 691694.[Medline]
Panganiban G, Sebring A, Nagy L, Carroll S (1995) The development of crustacean limbs and the evolution of arthropods. Science 270: 13631366.
Parnavelas JG (2000) The origin and migration of cortical neurones: new vistas. Trends Neurosci 23:126131.[CrossRef][Web of Science][Medline]
Peles E, Bacus SS, Koski RA, Lu HS, Wen D, Ogden SG, Levy RB, Yarden Y (1992) Isolation of the neu/HER-2 stimulatory ligand: a 44 kDa glycoprotein that induces differentiation of mammary tumor cells. Cell 69:205216.[CrossRef][Web of Science][Medline]
Pinkas-Kramarski R, Eilam R, Spiegler O, Lavi S, Liu N, Chang D, Wen D, Schwartz M, Yarden Y (1994) Brain neurons and glial cells express Neu differentiation factor/heregulin: a survival factor for astrocytes. Proc Natl Acad Sci USA 91:93879391.
Pinkas-Kramarski R, Eilam R, Alroy I, Levkowitz G, Lonai P, Yarden Y (1997) Differential expression of NDF/neuregulin receptors ErbB-3 and ErbB-4 and involvement in inhibition of neuronal differentiation. Oncogene 15:28032815.[CrossRef][Web of Science][Medline]
Pleasure SJ, Anderson S, Hevner R, Bagri A, Marin O, Lowenstein DH, Rubenstein JL (2001) Cell migration from the ganglionic eminences is required for the development of hippocampal GABAergic interneurons. Neuron 28:727740.
Plowman GD, Green JM, Culouscou JM, Carlton GW, Rothwell VM, Buckley S (1993) Heregulin induces tyrosine phosphorylation of HER4/p180erbB4. Nature 366:473475.[CrossRef][Medline]
Rakic P (1988) Specification of cerebral cortical areas. Science 241: 170176.
Rieff HI, Raetzman LT, Sapp DW, Yeh HH, Siegel RE, Corfas G (1999) Neuregulin induces GABAA receptor subunit expression and neurite outgrowth in cerebellar granule cells. J Neurosci 19:1075710766.
Riese DJ, Bermingham Y, van Raaij TM, Buckley S, Plowman GD, Stern DF (1996) Betacellulin activates the epidermal growth factor receptor and erbB-4, and induces cellular response patterns distinct from those stimulated by epidermal growth factor or neuregulin-beta. Oncogene 12:345353.[Web of Science][Medline]
Rio C, Rieff HI, Qi P, Khurana TS, Corfas G (1997) Neuregulin and erbB receptors play a critical role in neuronal migration. Neuron 19:3950. [Published erratum appears in Neuron (1997) 19:1349.]
Shindler KS, Roth KA (1996) Double immunofluorescent staining using two unconjugated primary antisera raised in the same species. J Histochem Cytochem 44:13311335.[Abstract]
Shinozaki K, Miyagi T, Yoshida M, Miyata T, Ogawa M, Aizawa S, Suda Y (2002) Absence of CajalRetzius cells and subplate neurons associated with defects of tangential cell migration from ganglionic eminence in Emx1/2 double mutant cerebral cortex. Development 129: 34793492.[Web of Science][Medline]
Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, Sigmundsson T, Ghosh S, Brynjolfsson J, Gunnarsdottir S, Ivarsson O, Chou TT, Hjaltason O, Birgisdottir B, Jonsson H, Gudnadottir VG, Gudmundsdottir E, Bjornsson A, Ingvarsson B, Ingason A, Sigfusson S, Hardardottir H, Harvey RP, Lai D, Zhou M, Brunner D, Mutel V, Gonzalo A, Lemke G, Sainz J, Johannesson G, Andresson T, Gudbjartsson D, Manolescu A, Frigge ML, Gurney ME, Kong A, Gulcher JR, Petursson H, Stefansson K (2002) Neuregulin 1 and susceptibility to schizophrenia. Am J Hum Genet (in press).
Steiner H, Blum M, Kitai ST, Fedi P (1999) Differential expression of ErbB3 and ErbB4 neuregulin receptors in dopamine neurons and forebrain areas of the adult rat. Exp Neurol 159:494503.[CrossRef][Web of Science][Medline]
Stuhmer T, Puelles L, Ekker M, Rubenstein JL (2002) Expression from a Dlx gene enhancer marks adult mouse cortical GABAergic neurons. Cereb Cortex 12:7585.
Sweeney C, Lai C, Riese DJ, Diamonti AJ, Cantley LC, Carraway KL (2000) Ligand discrimination in signaling through an ErbB4 receptor homodimer. J Biol Chem 275:1980319807.
Tamamaki N, Fujimori KE, Takauji R (1997) Origin and route of tangentially migrating neurons in the developing neocortical intermediate zone. J Neurosci 17:83138323.
Tan SS, Kalloniatis M, Sturm K, Tam PP, Reese BE, Faulkner-Jones B (1998) Separate progenitors for radial and tangential cell dispersion during development of the cerebral neocortex. Neuron 21:295304.[CrossRef][Web of Science][Medline]
Van Eden CG, Mrzljak L, Voorn P, Uylings HB (1989) Prenatal development of GABA-ergic neurons in the neocortex of the rat. J Comp Neurol 289:213227.[CrossRef][Web of Science][Medline]
Wang H-F, Liu F-C (2001) Developmental restriction of the LIM homeodomain transcription factor Isl-1 expression to cholinergic neurons in the striatum. Neuroscience 103:9991016.[CrossRef][Web of Science][Medline]
Weber J, Ledesma E, Battenberg M, Morales M, Bloom FE, Lemke G, Lai C (1996) The erbB4 receptor is expressed in cells which express the neurotransmitter GABA. Soc Neurosci Abstr 22:1579.
Weber JL, Fung E, McCann C, Anton ES, Lai C (2000) Neuregulin and ErbB expression in the rostral migratory stream. Soc Neurosci Abstr 26:57.
Wen D, Peles E, Cupples R, Suggs SV, Bacus SS, Luo Y, Trail G, Hu S, Silbiger SM, Levy RB (1992) Neu differentiation factor: a trans-membrane glycoprotein containing an EGF domain and an immunoglobulin homology unit. Cell 69:559572.[CrossRef][Web of Science][Medline]
Wichterle H, Garcia-Verdugo JM, Herrera DG, Alvarez-Buylla A (1999) Young neurons from medial ganglionic eminence disperse in adult and embryonic brain. Nat Neurosci 2:461466.[CrossRef][Web of Science][Medline]
Wichterle H, Turnbull DH, Nery S, Fishell G, Alvarez-Buylla A (2001) In utero fate mapping reveals distinct migratory pathways and fates of neurons born in the mammalian basal forebrain. Development 128:37593771.
Wilson SW, Rubenstein JL (2000) Induction and dorsoventral patterning of the telencephalon. Neuron 28:641651.[CrossRef][Web of Science][Medline]
Yau H-J, Wang H-F, Lai C, Liu F-C (2001) Developmental expression of the neuregulin receptor ErbB4 in the rat forebrain. Soc Neurosci Abstr 27:473.1.
Yee KT, OLeary DDM (2001) Migrating basilar pontine and inferior olive neurons express ErbB4. Soc Neurosci Abstr 27:692.7.
Zhang D, Sliwkowski MX, Mark M, Frantz G, Akita R, Sun Y, Hillan K, Crowley C, Brush J, Godowski PJ (1997) Neuregulin-3 (NRG3): a novel neural tissue-enriched protein that binds and activates ErbB4. Proc Natl Acad Sci USA 94:95629567.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Fisahn, J. Neddens, L. Yan, and A. Buonanno Neuregulin-1 Modulates Hippocampal Gamma Oscillations: Implications for Schizophrenia Cereb Cortex, March 1, 2009; 19(3): 612 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Krivosheya, L. Tapia, J. N. Levinson, K. Huang, Y. Kang, R. Hines, A. K. Ting, A. M. Craig, L. Mei, S. X. Bamji, et al. ErbB4-Neuregulin Signaling Modulates Synapse Development and Dendritic Arborization through Distinct Mechanisms J. Biol. Chem., November 21, 2008; 283(47): 32944 - 32956. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Liodis, M. Denaxa, M. Grigoriou, C. Akufo-Addo, Y. Yanagawa, and V. Pachnis Lhx6 Activity Is Required for the Normal Migration and Specification of Cortical Interneuron Subtypes J. Neurosci., March 21, 2007; 27(12): 3078 - 3089. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Kroll and D. D. M. O'Leary Ventralized dorsal telencephalic progenitors in Pax6 mutant mice generate GABA interneurons of a lateral ganglionic eminence fate PNAS, May 17, 2005; 102(20): 7374 - 7379. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gambarotta, D. Garzotto, E. Destro, B. Mautino, C. Giampietro, S. Cutrupi, C. Dati, E. Cattaneo, A. Fasolo, and I. Perroteau ErbB4 Expression in Neural Progenitor Cells (ST14A) Is Necessary to Mediate Neuregulin-1{beta}1-induced Migration J. Biol. Chem., November 19, 2004; 279(47): 48808 - 48816. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











